ORFeome > cdc37 ORF1 – XORFeome v1.0

cdc37 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdc37
Gene ID: 6078393
Gene Page ID: 979268
ORF Xenbase ID: 17268609

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041715
Original XGC clone length: 1116

Human orthology & disease relationships

NCBI Entrez ID: 11140
Ensembl gene IDs: ENSG00000105401
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,259500,609048

Library Location

Plate ID: GDExl11007
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ823557
dbEST ID: 79641259
Trimmed Sequence: ATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGATGAAGATGACACTCATCCCAACATTGATACGGCCAGTCTCTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGAATGGAGGAGTTCGACAAGGAGAAAGAGGAGTTATCGAAAGCCGCCAATGATAGTAAGAAGAAGCTGGCGGAGTGTCAGAAAAAGCTGAATGAGCTGGGCCTTAAAGATGGAGCGCAAAGTGAGATACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAAGAGCAAAAGGACTGGGAGAAGAAAGAGAACGAATTGAGAAAGAAAGAGAAGACTATGCCTTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAATGTAAAACCTGAAAACAAGCAAGTAACAGAGGAGGAGAAAGAGCAAAAGCACAAAACCTTTGTCGAAAAGAATGTCAAGCAGCTGAAGCACTTTGGTATGCTCCACCGCTGGGATGACAGTCAAAAATATTTATCAGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACCTAGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCCCTTATGGAACAAGTCGCCCATCAGACTATTGTTATGCAGTTTGTTCTGGAACTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAAAATCAGACTGCAGACCAGCAATATATGGACGCCTTTAATGATGGAATGGGAATCTGTTCAGGGGCAGAAGTN
Full Trace Sequence: CAGTATTGATTTTATTTATGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGGATTATAGCGTGTGGGACCACATTGAAGTTTCTGATGATGAAGATGACACTCATCCCAACATTGATACGGCCAGTCTCTTCCGATGGCGTCACCAGGCCCGCGTGGAAAGAATGGAGGAGTTCGACAAGGAGAAAGAGGAGTTATCGAAAGCCGCCAATGATAGTAAGAAGAAGCTGGCGGAGTGTCAGAAAAAGCTGAATGAGCTGGGCCTTAAAGATGGAGCGCAAAGTGAGATACAGAAGCTACAGTCAGACCTGTGTCAGCTGAAGAAAGAGCAAAAGGACTGGGAGAAGAAAGAGAACGAATTGAGAAAGAAAGAGAAGACTATGCCTTGGAATGTAGACACTCTGAGCAAGGAGGGCTTTAGCAAGAGTGTATTTAATGTAAAACCTGAAAACAAGCAAGTAACAGAGGAGGAGAAAGAGCAAAAGCACAAAACCTTTGTCGAAAAGAATGTCAAGCAGCTGAAGCACTTTGGTATGCTCCACCGCTGGGATGACAGTCAAAAATATTTATCAGATAACCCTCATCTGGTGTGTGAAGAGACTGCCAACTACCTAGTCATCTGGTGCATTGATTTAGAAGTGGAAGAGAAACACGCCCTTATGGAACAAGTCGCCCATCAGACTATTGTTATGCAGTTTGTTCTGGAACTGGCCAAGAGCTTGAAGGTGGATCCCAGGGCCTGCTTCCGACAGTTCTTCACCAAAAATCAGACTGCAGACCAGCAATATATGGACGCCTTTAATGATGGAATGGGAATCTGTTCAGGGGCAGAAGTN
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGATTATAGCGTGTGGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ828855
dbEST ID: 79646557
Trimmed Sequence: CGAAGTCTCCGGCTGGTCAGCAGCTTCATATACAGGTTCTGAGTCAGGAGCCTCAGACTCTGTAACATCTGCTGCCTTTGAATTCGGAACCCAAAGTCCAGAGTCAATACACTGCTTCATGTAAATTCTTGCTTCATTAGGGTCCATTTTGCTGATGGTATCCTGTAACAGCTGAATGTCTTTCGTATCAAAACAATTCTGAAGCTCAGGTGGAAGAGATTCATAAACCTCCACAGGATCCAGCCCTCCCGGACCAAGTCTCTTTTTCCGTTCCTCCTCCTCGTACTCCTTCATTGCCTTCTCTATTCGAACCTTGGCTCTCTCCCTAACTCTGCCCTTGAAGGATTCCAATTCATCATTAAAGGCGTCCATATATTGCTGGTCTGCAGTCTTGATTTTGGTGAAGAACTGTCGGAAGCAGGCCCTGGGATCCACCTTCAAGCTCTTGGCCAGTTCCAGAACAAACTGCATAACAATAGTCTGATGGGCGACTTGTTCCATAAGGGCGTGTTTCTCTTCCACTTCTAAATCAATGCACCAGATGACTAGGTAGTTGGCAGTCTCTTCACACACCAGATGAGGGTTATCTGATAAATATTTTTGACTGTCATCCCAGCGGTGGAGCATACCAAAGTGCTTCAGCTGCTTGACATTCTTTTCGACAAAGGTTTTGTGCTTTTTGCTCTTTC
Full Trace Sequence: GGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGAAGTCTCCGGCTGGTCAGCAGCTTCATATACAGGTTCTGAGTCAGGAGCCTCAGACTCTGTAACATCTGCTGCCTTTGAATTCGGAACCCAAAGTCCAGAGTCAATACACTGCTTCATGTAAATTCTTGCTTCATTAGGGTCCATTTTGCTGATGGTATCCTGTAACAGCTGAATGTCTTTCGTATCAAAACAATTCTGAAGCTCAGGTGGAAGAGATTCATAAACCTCCACAGGATCCAGCCCTCCCGGACCAAGTCTCTTTTTCCGTTCCTCCTCCTCGTACTCCTTCATTGCCTTCTCTATTCGAACCTTGGCTCTCTCCCTAACTCTGCCCTTGAAGGATTCCAATTCATCATTAAAGGCGTCCATATATTGCTGGTCTGCAGTCTTGATTTTGGTGAAGAACTGTCGGAAGCAGGCCCTGGGATCCACCTTCAAGCTCTTGGCCAGTTCCAGAACAAACTGCATAACAATAGTCTGATGGGCGACTTGTTCCATAAGGGCGTGTTTCTCTTCCACTTCTAAATCAATGCACCAGATGACTAGGTAGTTGGCAGTCTCTTCACACACCAGATGAGGGTTATCTGATAAATATTTTTGACTGTCATCCCAGCGGTGGAGCATACCAAAGTGCTTCAGCTGCTTGACATTCTTTTCGACAAAGGTTTTGTGCTTTTTGCTCTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGAAGTCTCCGGCTGGT