ORFeome > cdc42ep4 ORF1 – XORFeome v1.0

cdc42ep4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cdc42ep4
Gene ID: 1016124
Gene Page ID: 1016117
ORF Xenbase ID: 17268639

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC133274
Original XGC clone length: 909

Human orthology & disease relationships

NCBI Entrez ID: 23580
Ensembl gene IDs: ENSG00000179604
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 124900,153640,153650,155100,301000,313900,603622,605249,608203

Library Location

Plate ID: GDExl11006
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ840194
dbEST ID: 79657896
Trimmed Sequence: ATGCCTATACTTAAGCAACTGGTCACCCATCCCACTGCCTCAAAGAGGCGCTCGCGGGCAGACCTCACATCGGAAATGATCAGTGCTCCACTGGGTGATTTTCGGCACACAATGCACATTGGAAGGGCAGGTGATGCCTTTGGAGACACATCCTTTCTTGGCAGCAAAGGTGATGATCAACCAGAATCAGAAGAATCTTTTTCCAAGCCAGGACTGCTTTCCAGAACATTTCGCAGCAGCAAACGTTCCCTTTCAGTGACACGCAGTGACCGTAGAGACATGCTAGGTTCCGTCAGGGACTCTGCTTTTTTTGTAAAAAATGCTGTTTCCTTGCCCCAGTTGACTGAGAAGGAGGCTGAAAAGAGTTCTTCCAAGAAAATGCCAAAAAGCCTCTCTTCCAGCCCAGTAAAGAAGGTGCCTGAAGAGCAGCATATAAATGGGGCATCAGCTCAAAGTCCAACAACTGTTCCCGATGCAGCCTCTGTAGAGAGAGAATTTGGAGAACTAACAGACTTGCCAGATCCTGCACCAAAGAGCAGCTCTGGTATGAAGCATGCAGAGTCTATCATGTCATTCCATATTGACCTAGGTCCATCTATGTTAGGGGATATCTTAAGTGTCATGGACAATAATGAGTGGGAGAAGGACCTGGACCATAGCCTTGATGACCTTGATAAAAATGGCTCTGGCTTACTTCCTTCCTGGCAGACTCATCCTCCACAAAACAGTTACCCCATCAAGTGCCCCCTAAGGCCAAAAA
Full Trace Sequence: CGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTATACTTAAGCAACTGGTCACCCATCCCACTGCCTCAAAGAGGCGCTCGCGGGCAGACCTCACATCGGAAATGATCAGTGCTCCACTGGGTGATTTTCGGCACACAATGCACATTGGAAGGGCAGGTGATGCCTTTGGAGACACATCCTTTCTTGGCAGCAAAGGTGATGATCAACCAGAATCAGAAGAATCTTTTTCCAAGCCAGGACTGCTTTCCAGAACATTTCGCAGCAGCAAACGTTCCCTTTCAGTGACACGCAGTGACCGTAGAGACATGCTAGGTTCCGTCAGGGACTCTGCTTTTTTTGTAAAAAATGCTGTTTCCTTGCCCCAGTTGACTGAGAAGGAGGCTGAAAAGAGTTCTTCCAAGAAAATGCCAAAAAGCCTCTCTTCCAGCCCAGTAAAGAAGGTGCCTGAAGAGCAGCATATAAATGGGGCATCAGCTCAAAGTCCAACAACTGTTCCCGATGCAGCCTCTGTAGAGAGAGAATTTGGAGAACTAACAGACTTGCCAGATCCTGCACCAAAGAGCAGCTCTGGTATGAAGCATGCAGAGTCTATCATGTCATTCCATATTGACCTAGGTCCATCTATGTTAGGGGATATCTTAAGTGTCATGGACAATAATGAGTGGGAGAAGGACCTGGACCATAGCCTTGATGACCTTGATAAAAATGGCTCTGGCTTACTTCCTTCCTGGCAGACTCATCCTCCACAAAACAGTTACCCCATCAAGTGCCCCCTAAGGCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTATACTTAAGCAACTGGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ840193
dbEST ID: 79657895
Trimmed Sequence: CACTCTGATTTCATCTTCCTCATCCATAAAAGAAAAGTCTCTCCCCTTCTTTGATTTGTCTTCCTTGACAACTGATCTGTCTCTAGACTTTGAATGATTGTTTTTGGACACTTTACTGTTGGTTACTCTGGCAGAAGTAGACATTTTGCTTTCTGCATTAGGGGCACATGATGGGTAACCTGTTTGTGGAGGATGAGTCTGCCAGGAAGGAAGTAAGCCAGAGCCATTTCTATCAAGGTCATCAAGGCTATGGTCCAGGTCCTTCTCCCACTCATTATTGTCCATGACACTTAAGATATCCCCTAACATAGATGGACCTAGGTCAATATGGAATGACATGATAGACTCTGCATGCTTCATACCAGAGCTGCTCTTTGGTGCAGGATCTGGCAAGTCTGTTAGTTCTCCAAATTCTCTCTCTACAGAGGCTGCATCGGGAACAGTTGTTGGACTTTGAGCTGATGCCCCATTTATATGCTGCTCTTCAGGCACCTTCTTTACTGGGCTGGAAGAGAGGCTTTTTGGCATTTTCTTGGAAGAACTCTTTTCAGCCTCCTTCTCAGTCAACTGGGGCAAGGAAAACAGCATTTTTTACAAAAAAAGCAGAGTCCCCTGAAGGAACCTAACAGGTCTCTACGGTCACTGGCGTGTCACTGAAAAGGAAACGTTTGGCTGCTTCGAAAATGTTCTGGAAACCAGTCCTGGGCTTTGAAAAAAAAATCCTTCCGAAATTCTGG
Full Trace Sequence: GGCGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTCTGATTTCATCTTCCTCATCCATAAAAGAAAAGTCTCTCCCCTTCTTTGATTTGTCTTCCTTGACAACTGATCTGTCTCTAGACTTTGAATGATTGTTTTTGGACACTTTACTGTTGGTTACTCTGGCAGAAGTAGACATTTTGCTTTCTGCATTAGGGGCACATGATGGGTAACCTGTTTGTGGAGGATGAGTCTGCCAGGAAGGAAGTAAGCCAGAGCCATTTCTATCAAGGTCATCAAGGCTATGGTCCAGGTCCTTCTCCCACTCATTATTGTCCATGACACTTAAGATATCCCCTAACATAGATGGACCTAGGTCAATATGGAATGACATGATAGACTCTGCATGCTTCATACCAGAGCTGCTCTTTGGTGCAGGATCTGGCAAGTCTGTTAGTTCTCCAAATTCTCTCTCTACAGAGGCTGCATCGGGAACAGTTGTTGGACTTTGAGCTGATGCCCCATTTATATGCTGCTCTTCAGGCACCTTCTTTACTGGGCTGGAAGAGAGGCTTTTTGGCATTTTCTTGGAAGAACTCTTTTCAGCCTCCTTCTCAGTCAACTGGGGCAAGGAAAACAGCATTTTTTACAAAAAAAGCAGAGTCCCCTGAAGGAACCTAACAGGTCTCTACGGTCACTGGCGTGTCACTGAAAAGGAAACGTTTGGCTGCTTCGAAAATGTTCTGGAAACCAGTCCTGGGCTTTGAAAAAAAAATCCTTCCGAAATTCTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTCTGATTTCATCTTCCTCAT