ORFeome > cdc42se1 ORF1 – XORFeome v1.0

cdc42se1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cdc42se1
Gene ID: 6254352
Gene Page ID: 945192
ORF Xenbase ID: 17268645

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078508
Original XGC clone length: 240

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839706
dbEST ID: 79657408
Trimmed Sequence: ATGAGTGACTTTTGGCACAAGCTGGGCTGCTGCGTCGTAGAAAAGCCACAACCAAAGAAGAAGCGGAAGAGAATTGACCGATCGATGATCGGAGAGCCTATGAATTTTGTCCACTTGACTCACGTTGGGTCAGGAGATATGGGAGCCGGTGATGGACTTCCAATGGCCGGTACAGTCCAGCAGCAGATGAGGTCCAAATGTGGACGTGACAGACAGTGGAGCAACTCCAGAGTTTTGTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGTGACTTTTGGCACAAGCTGGGCTGCTGCGTCGTAGAAAAGCCACAACCAAAGAAGAAGCGGAAGAGAATTGACCGATCGATGATCGGAGAGCCTATGAATTTTGTCCACTTGACTCACGTTGGGTCAGGAGATATGGGAGCCGGTGATGGACTTCCAATGGCCGGTACAGTCCAGCAGCAGATGAGGTCCAAATGTGGACGTGACAGACAGTGGAGCAACTCCAGAGTTTTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGTCCGAGCGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAATCAATGATGAAACAAACACCAGGCCCAAAAAACCAGGCAAAAAAAAAAACAAAGGGCCCTCGGAAACCGGGGCTGCCGGGTTATGGCCCTGTTTCCGGGGAGACCCCGGGGGCCCGGGGGACAACCCCGGGGGGGGTTTTGAGATGGGAGGGGCAATACCCGGGGGGGCCCCCCCCCGGGTTCAAAACCATAACAAAAAAGGAAAGGGGGGGAGGGGGGGGGGGGGTTTTTGGGGTGGTTACTGTGGTTTTTTGGGGGGTGGTGGGGACCGGCGGCACCGGGGGGAGTTTTCGGCCGTTGTGGTTGGGTTTGTTTTTTGGGTGGGGGCAATCTTTTTTCCCCCGGCGGCGCCCCCCCCCTAACAGCGGTCTTTAAAGGGGGAGGGGGGGGGTGTTGGTTGGTAAATTATTATG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTGACTTTTGGCACAAGCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ839705
dbEST ID: 79657407
Trimmed Sequence: CAAAACTCTGGAGTTGCTCCACTGTCTGTCACGTCCACATTTGGACCTCATCTGCTGCTGGACTGTACCGGCCATTGGAAGTCCATCACCGGCTCCCATATCTCCTGACCCAACGTGAGTCAAGTGGACAAAATTCATAGGCTCTCCGATCATCGATCGGTCAATTCTCTTCCGCTTCTTCTTTGGTTGTGGCTTTTCTACGACGCAGCAGCCCAGCTTGTGCCAAAAGTCACTCATGG
Full Trace Sequence: AAGATGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAACTCTGGAGTTGCTCCACTGTCTGTCACGTCCACATTTGGACCTCATCTGCTGCTGGACTGTACCGGCCATTGGAAGTCCATCACCGGCTCCCATATCTCCTGACCCAACGTGAGTCAAGTGGACAAAATTCATAGGCTCTCCGATCATCGATCGGTCAATTCTCTTCCGCTTCTTCTTTGGTTGTGGCTTTTCTACGACGCAGCAGCCCAGCTTGTGCCAAAAGTCACTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGTCCAACCTTAATACTGGCCGTCGAAAAACAACTAAGAGACTGGGGTACCTCATGTCTAAAATCCCCCGCCCAAAAAAAAAGCGCGGGCTCAGGGACACCCGGGCCTCTCATTTAACATTTCTTGGCAATGAGAAAACCCGAGACTATGGAAAACCACGGGGGGTGGTGTGAAAGCTGTGACCAAAAGAAGAAAGGGGCCCCCCGGGGGGGCAAATCTCAAAAAGGGAACGAGGTGGGCGCGGGGGGGGGGGTTTTACAGAGTTTTTATAAATATTTNTGGGTGGATACAAGCCGCCTTCTCCCACACCACAGAAGACCCTCTCCCCGGGGGTTGTTGTGGGTGGTGAACCACAGCAGAGAGTGTTTCTCACAACGGGGCACCCCCCCCGNCCAAACACCAGTAGGGGGGAGAAGGGGAGGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAACTCTGGAGTTGCTCCAC