ORFeome > cdc5l ORF2 – XORFeome v1.0

cdc5l ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdc5l
Gene ID: 983559
Gene Page ID: 983550
ORF Xenbase ID: 17268693

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128682
Original XGC clone length: 2415

Human orthology & disease relationships

NCBI Entrez ID: 988
Ensembl gene IDs: ENSG00000096401
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A08

Sequences - 5ʹ (forward) EST

Accession: JZ837471
dbEST ID: 79655173
Trimmed Sequence: ATGCCGCGTATTATGATAAAAGGCGGGGTGTGGCGGAACACAGAAGATGAAATTCTCAAAGCGGCTGTTATGAAATATGGGAAAAACCAGTGGTCTCGAATTGCTTCTTTGCTGCACACAAAATCCGCCAAACAGTGCAAAGCCCGATGGTATGAATGGCTTGACCCGAACATCAAAAACACAGAATGGTCTCGGGAAGAAGAAGAGAAATTACTTCATTTGGCCAAGCTGATGCCAACTCAGTGGAGGACAATTGCTCCTATCATAAGAAGAACTGCAGCCCAGTGCCTGGAGCACTATGAATATTTGCTAGATAAAGCTGCTCAGCGAGACAATGAAGAAGAGACCGCACACGACCCTCGCAAGCTGAAGCCAAGAAAAATTGATCCATATCCCGAAACAAAACCCGCGAGGCCAGATCCTGTGGACATGGATGAAGATGAACTTGATATGCTTTCAGAGGCTAGAGCTCGTCTTGCCCACACTCAGGGCAAAAAAGCCAAGAAGAAAGCAAGAGAAAAACAGCTGGAAAACCCCACGCGTCATGCAGCCCTTCAGAAGAAGAGAGAGCTTCGTGCTGCCGGCAGTGATATTCAGAAGAAGAGGAAAAGAAACGTGGAGTGGACTACTATGCAAATATTCCTTTTGAAAAAAAGCCGGCGCCAGGGTTCTACGATACATCTAAAGAAAACTATGATGCCTTGAATGCCCACTTCAAAAAGCTCCGTCAACAACACCCTGGATGGCCACCGGAAAATCAAAAAAAAAACCAAAGAACCGAAAGGAAAAAAAACAAAAAAATTAAAAAGAAAAAAAGGAAACA
Full Trace Sequence: TCGGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCGTATTATGATAAAAGGCGGGGTGTGGCGGAACACAGAAGATGAAATTCTCAAAGCGGCTGTTATGAAATATGGGAAAAACCAGTGGTCTCGAATTGCTTCTTTGCTGCACACAAAATCCGCCAAACAGTGCAAAGCCCGATGGTATGAATGGCTTGACCCGAACATCAAAAACACAGAATGGTCTCGGGAAGAAGAAGAGAAATTACTTCATTTGGCCAAGCTGATGCCAACTCAGTGGAGGACAATTGCTCCTATCATAAGAAGAACTGCAGCCCAGTGCCTGGAGCACTATGAATATTTGCTAGATAAAGCTGCTCAGCGAGACAATGAAGAAGAGACCGCACACGACCCTCGCAAGCTGAAGCCAAGAAAAATTGATCCATATCCCGAAACAAAACCCGCGAGGCCAGATCCTGTGGACATGGATGAAGATGAACTTGATATGCTTTCAGAGGCTAGAGCTCGTCTTGCCCACACTCAGGGCAAAAAAGCCAAGAAGAAAGCAAGAGAAAAACAGCTGGAAAACCCCACGCGTCATGCAGCCCTTCAGAAGAAGAGAGAGCTTCGTGCTGCCGGCAGTGATATTCAGAAGAAGAGGAAAAGAAACGTGGAGTGGACTACTATGCAAATATTCCTTTTGAAAAAAAGCCGGCGCCAGGGTTCTACGATACATCTAAAGAAAACTATGATGCCTTGAATGCCCACTTCAAAAAGCTCCGTCAACAACACCCTGGATGGCCACCGGAAAATCAAAAAAAAAACCAAAGAACCGAAAGGAAAAAAAACAAAAAAATTAAAAAGAAAAAAAGGAAACA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCGTATTATGATAAAAGG

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAGTATGGCTTCGTAGCTTTCTTTCTCCAGCATAAGCTCGGCAAATCTCTGCTGCAGTTCCCTCTCTCGCTCTTCCTGTCGCTGGACGTCCTCTTTCAGACACTCTATCCTTCTTGGAATGGCGGTATCTTCATGCACTTTAAGTTCTTCGAAAGTTCCCAATTCCAGGTTGGCCTGTTCGTACTGATCCCAAATCTCATTCAGCTGTTTGATGAGCCCCATGGCCCGGGACTGGTACCCACAAACCAATATATACCACTGCTTCTTCCCTTAGGTTGCACTTTCCGGCTTCTACAATTTCGTCACCTCTGTTCATCCCTACCTCTCTTCTCTAGTGATTCAATCCTGTCCTTTTTGCTGGTCAGGTTGGCCCTTGTGTTATGACCTTGTCTTGGACAGTACTATATTGCGACTAAAAACTCACTCATCCATCTGAATAGTATCATTATTTCGAGACGTCACCTTGGACCATACCTTGCTTCTACACTCCAATCTCTTTGGTGCAGGACTTCCTCTGCCTGCTTGAGTTCCTCCTTACTATACTTTACAAATGGCATGTGTTCCAGAAAGGCAATGCTTTTCGCGTTGGCAAGCGCTGAGCCAGGCACCTTCCCTCCTCTCCCTCCAACTTATCCGCGTAAGGAAGGTGGAAGGTATGGGAATTGCACCATCACAACCATTTCTTTTTTAATCTTTCCTCCTTTTTCGGCAAATCTTTAAAATGGAGGCTCTGAAGTTTGAAGGCCCTTCAAAAAAAATTTTCATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTATGGCTTCGTAGCTT