ORFeome > cdca8 ORF1 – XORFeome v1.0

cdca8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdca8
Gene ID: 946933
Gene Page ID: 946928
ORF Xenbase ID: 17268729

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106697
Original XGC clone length: 843

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ837210
dbEST ID: 79654912
Trimmed Sequence: ATGGCATCTGGGAAAAAGAAGACCAGTCGCAAACCTAAAAACCGCTCTGTGAAAAATGAGAAGCTAGCTTCATTCATCAAGGATTTTGACAGCCAAGTCAAGATTATCACAGAAGAAATGAAGGCAAGCGTTGTAAATATACTTAAAGAAGTGGATAGCCAGTATAATATTGAAATAATCAAATTGCCTATGGCTATACGAGAAATGTGCTGGCTGGATTACATTGCAAAAGGTGGAAGTCAAAAGGCATTGGAGGCAGCTGCCACGGTGAAGGTAGACATGGAAGAAATAACATCTACTGTAACCAAAACACCATTCAAGGCAGACAAGAAAGTGAAAAAGGGAAAATGTAAGCCTGATGATGAAACAGTGGAACTAAATCCTCTGAAAAGTGTAATCAGAACAAAAACTAAGGCCAAGGTTGCTGCAAAGAAACCATCTACTGCAAGAAGAACTCGAGCTTCTGTTGGAAACGTAGCCAACACCAGCAAAAGGACGAGTAAGAGAGGTCGTGCAACACCTTCTGCAAGCAAACAAGCTGAGACCTCTTTATTGGGATATACACCTGCTGCTACCCCTAGAATTGATACCAGCATATTTAAAACTCCAGCGCTGCCCCCGCCCTGCATGGCGGAACCTGTGTACACATTCTCTGCTAACGGCAGCCCCTTTGGCGGGAAGGGATGAACCGGTTAATCAATGGTACCTGCAAAAAAGGGAAAAAATAGTTCTCCTTTTGGCCATTTAAAGGTGAAAGGGTTTGGGATTATTTATCGCGTTAAAACAGAGCAAGGCATTTTTTAAAAAC
Full Trace Sequence: CGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGGGAAAAAGAAGACCAGTCGCAAACCTAAAAACCGCTCTGTGAAAAATGAGAAGCTAGCTTCATTCATCAAGGATTTTGACAGCCAAGTCAAGATTATCACAGAAGAAATGAAGGCAAGCGTTGTAAATATACTTAAAGAAGTGGATAGCCAGTATAATATTGAAATAATCAAATTGCCTATGGCTATACGAGAAATGTGCTGGCTGGATTACATTGCAAAAGGTGGAAGTCAAAAGGCATTGGAGGCAGCTGCCACGGTGAAGGTAGACATGGAAGAAATAACATCTACTGTAACCAAAACACCATTCAAGGCAGACAAGAAAGTGAAAAAGGGAAAATGTAAGCCTGATGATGAAACAGTGGAACTAAATCCTCTGAAAAGTGTAATCAGAACAAAAACTAAGGCCAAGGTTGCTGCAAAGAAACCATCTACTGCAAGAAGAACTCGAGCTTCTGTTGGAAACGTAGCCAACACCAGCAAAAGGACGAGTAAGAGAGGTCGTGCAACACCTTCTGCAAGCAAACAAGCTGAGACCTCTTTATTGGGATATACACCTGCTGCTACCCCTAGAATTGATACCAGCATATTTAAAACTCCAGCGCTGCCCCCGCCCTGCATGGCGGAACCTGTGTACACATTCTCTGCTAACGGCAGCCCCTTTGGCGGGAAGGGATGAACCGGTTAATCAATGGTACCTGCAAAAAAGGGAAAAAATAGTTCTCCTTTTGGCCATTTAAAGGTGAAAGGGTTTGGGATTATTTATCGCGTTAAAACAGAGCAAGGCATTTTTTAAAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGGGAAAAAGAAGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837209
dbEST ID: 79654911
Trimmed Sequence: CTTTAGTTTCTTGCACAGCCTTTCGAGTCGACTTGAGAGAAGTTTAATGTTTTCAAATGCTTGCTGGTCTAAGCGATTAATATCCAAACCGTCCACTTCACTGGCCAGAAGACGAATAATCTTTCCATCTCTTGCAGGTACATTGATAAACAGCTCATCCATACCAGCCAAAGGGCTGCCGTTAGCAGAGAATGTGTACACAGGTTCCTGCATGCATGGCGTGCGCAGCGCTGGAGTTTTAAATATGCTGGTATCAATTCTAGGGGTAGCAGCAGGTGTATATCCCAATAAAGAGGTCTCAGCTTGTTTGCTTGCAGAAGGTGTTGCACGACCTCTCTTACTCGTCCTTTTGCTGGTGTTGGCTACATTTCCAACAGAAGCTCGAGTTCTTCTTGCAGTAGAAAGTGGCTTTGCAGCAGCCTTGGCCGTAGTTTTTGTTCTGATTACACTTTTCTTAAAAGTGGGTTCCACTGTTTCGTCATCGCGCTTGGGTTTTCCCTTGTGCGGGTTCTTGTCGCGGTAAAGTGAGTGGTGGGGGGATAAAAAGTAGATGTTGCTTGCCTCGGGTCGACGGGGGGGGGGGGGGGGGGGGGGGGGGGGTTTTCGGGTTTGGTGGTGTGGGGGGGGGAGCAGATTTCTGGTGGGGGGGGGGGGCGGGGGGGATATAAAGAGATATCAAAAGACAGCCGGGGGCGATAAGTTC
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTAGTTTCTTGCACAGCCTTTCGAGTCGACTTGAGAGAAGTTTAATGTTTTCAAATGCTTGCTGGTCTAAGCGATTAATATCCAAACCGTCCACTTCACTGGCCAGAAGACGAATAATCTTTCCATCTCTTGCAGGTACATTGATAAACAGCTCATCCATACCAGCCAAAGGGCTGCCGTTAGCAGAGAATGTGTACACAGGTTCCTGCATGCATGGCGTGCGCAGCGCTGGAGTTTTAAATATGCTGGTATCAATTCTAGGGGTAGCAGCAGGTGTATATCCCAATAAAGAGGTCTCAGCTTGTTTGCTTGCAGAAGGTGTTGCACGACCTCTCTTACTCGTCCTTTTGCTGGTGTTGGCTACATTTCCAACAGAAGCTCGAGTTCTTCTTGCAGTAGAAAGTGGCTTTGCAGCAGCCTTGGCCGTAGTTTTTGTTCTGATTACACTTTTCTTAAAAGTGGGTTCCACTGTTTCGTCATCGCGCTTGGGTTTTCCCTTGTGCGGGTTCTTGTCGCGGTAAAGTGAGTGGTGGGGGGATAAAAAGTAGATGTTGCTTGCCTCGGGTCGACGGGGGGGGGGGGGGGGGGGGGGGGGGGGTTTTCGGGTTTGGTGGTGTGGGGGGGGGAGCAGATTTCTGGTGGGGGGGGGGGGCGGGGGGGATATAAAGAGATATCAAAAGACAGCCGGGGGCGATAAGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTAGTTTCTTGCACAGCCTT