ORFeome > cdca9 ORF1 – XORFeome v1.0

cdca9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdca9
Gene ID: 5865093
Gene Page ID: 5864999
ORF Xenbase ID: 17268735

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097903
Original XGC clone length: 891

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ838453
dbEST ID: 79656155
Trimmed Sequence: ATGCCGCCCAAGAGGAACAGAAATCGCTTAGGAACTCGGGGTGAGGGAAGTGGGGACTCTGGGGTTGGGATGTTTGAAAGGAATGATGCAGTTCAGGAGCATAAGAAAGAGAAGATCAGACTGTTCATGCAGGACTTTGTGCAACAAGGAAAAGACAGACTGGCAGAACTAAAGAAAGATCTGGAATCTTTGAGCACTACAGCAGATAAAGCTTTGGAAGTGGAGCTCTTGAAGATGCCCCTGGCTATCCGACACATGAAAGTCCAAGACTACCTTAGCTTAATGGGAGGTGACAAGAGTGCTGTTGCCGCAGCTGCCGTGAAGCTTGACTGTTGAGTTGATGAACTATCCGAGCCAAAACTAATCCTAAAAAACAGTAAGAAGGTTAAGGTCACCACAAATGTAGAATATCAGGATGATGTGAGAACAAAAGTGATGACAACCACCACAAAGAACATGACTGTACGGAAGGTGCCGAAGAGCAAATCTATGCTTTCGCTTACTGGTAAAAATGGCAAGAAAACTACTGCTCTAGCCAAGTCGGTGTCTGCCACCCCTTTAGACCAAGGTTCTAAAAAGCTATTGGTAGGGGGATTATCGATCCAAGCAGCCGAGCGGTCGGCGGAAACAGCGGAGACGCCAGTAAATCATTCTGCCCCGATTGGAAAGAGGTCAGCCTTTGCAAGACGGTGGTTTTTTGGAATAGAAGGGGG
Full Trace Sequence: GGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCGCCCAAGAGGAACAGAAATCGCTTAGGAACTCGGGGTGAGGGAAGTGGGGACTCTGGGGTTGGGATGTTTGAAAGGAATGATGCAGTTCAGGAGCATAAGAAAGAGAAGATCAGACTGTTCATGCAGGACTTTGTGCAACAAGGAAAAGACAGACTGGCAGAACTAAAGAAAGATCTGGAATCTTTGAGCACTACAGCAGATAAAGCTTTGGAAGTGGAGCTCTTGAAGATGCCCCTGGCTATCCGACACATGAAAGTCCAAGACTACCTTAGCTTAATGGGAGGTGACAAGAGTGCTGTTGCCGCAGCTGCCGTGAAGCTTGACTGTTGAGTTGATGAACTATCCGAGCCAAAACTAATCCTAAAAAACAGTAAGAAGGTTAAGGTCACCACAAATGTAGAATATCAGGATGATGTGAGAACAAAAGTGATGACAACCACCACAAAGAACATGACTGTACGGAAGGTGCCGAAGAGCAAATCTATGCTTTCGCTTACTGGTAAAAATGGCAAGAAAACTACTGCTCTAGCCAAGTCGGTGTCTGCCACCCCTTTAGACCAAGGTTCTAAAAAGCTATTGGTAGGGGGATTATCGATCCAAGCAGCCGAGCGGTCGGCGGAAACAGCGGAGACGCCAGTAAATCATTCTGCCCCGATTGGAAAGAGGTCAGCCTTTGCAAGACGGTGGTTTTTTGGAATAGAAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGCCCAAGAGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838452
dbEST ID: 79656154
Trimmed Sequence: GAGGGTATTCCCGTGGTGCTGAATGGAAGCTTTTGCACATAGGCTGGTTAGCTGGCCCACTAGGTTGTGAATGTGCTGCACTGTATCTCCTCTCAGTAGCTCCACATTTAGACTGTCCAAATCATCTCCTGCTGAAAAGACAGTCTTCCCATCAGCCAGTGGTATCTTGACAAACGGGACACCTTCATCCAAAAAAGCACCGTCTCCAAAGGTGAACATTGTATCACTCCGGGCAGAACGAGTTAGTGGAGTCATCGCTGTTCTTGATGACCGCTGGGCTGGTTTGCTGGATGAATTGGTTACCAATAGCTTTTTAGAAGCTTTGTCTAAAGGTGTGGCAGATACAGACCTGGTTAGAGCAGTAGTTTTCTTGCCATTTTTACCAATAAATGAAAGCATAGATTTGCTTTTTGGCACCTTTTGTACAGTCCTGTTCGTTGTGCTGGGTTGTCGTCACTTTTGTTCTCAGATCATCCTAGAATTCTACATTTGTGGTGACGGTAACCTTCTTAACGGTATTGCGGACTAGTTTTAGCTCGGAGGGTTAATCACCTAAAACATCAAAGCTTCCGGCCGCTTCGGGGGAGGGGGCACTGGTCCCCTCGGAGTAAGGTAAGGTGGTGTGGGGGGGTTGGGGGTGCCGGGAGGGGGGGGGGAGGGGGCGGGAGGGCCCCCATCCGACCCCTTCTCGGGGGGGGGGTGGGGGGGGGGAG
Full Trace Sequence: CGGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGGGTATTCCCGTGGTGCTGAATGGAAGCTTTTGCACATAGGCTGGTTAGCTGGCCCACTAGGTTGTGAATGTGCTGCACTGTATCTCCTCTCAGTAGCTCCACATTTAGACTGTCCAAATCATCTCCTGCTGAAAAGACAGTCTTCCCATCAGCCAGTGGTATCTTGACAAACGGGACACCTTCATCCAAAAAAGCACCGTCTCCAAAGGTGAACATTGTATCACTCCGGGCAGAACGAGTTAGTGGAGTCATCGCTGTTCTTGATGACCGCTGGGCTGGTTTGCTGGATGAATTGGTTACCAATAGCTTTTTAGAAGCTTTGTCTAAAGGTGTGGCAGATACAGACCTGGTTAGAGCAGTAGTTTTCTTGCCATTTTTACCAATAAATGAAAGCATAGATTTGCTTTTTGGCACCTTTTGTACAGTCCTGTTCGTTGTGCTGGGTTGTCGTCACTTTTGTTCTCAGATCATCCTAGAATTCTACATTTGTGGTGACGGTAACCTTCTTAACGGTATTGCGGACTAGTTTTAGCTCGGAGGGTTAATCACCTAAAACATCAAAGCTTCCGGCCGCTTCGGGGGAGGGGGCACTGGTCCCCTCGGAGTAAGGTAAGGTGGTGTGGGGGGGTTGGGGGTGCCGGGAGGGGGGGGGGAGGGGGCGGGAGGGCCCCCATCCGACCCCTTCTCGGGGGGGGGGTGGGGGGGGGGAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGGGTATTCCCGTGGT