ORFeome > cdip1 ORF1 – XORFeome v1.0

cdip1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdip1
Gene ID: 5752923
Gene Page ID: 5752850
ORF Xenbase ID: 17268753

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041237
Original XGC clone length: 624

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11008
Well Location: F12

Sequences - 5ʹ (forward) EST

Accession: JZ823644
dbEST ID: 79641346
Trimmed Sequence: ATGGCGAGTGACCCTCCCCCTCCTTACCCCGGGGGCCCATCGGCCCCACTGCTGGAGGACAAACATGGGGCTCCCAGAATGGAAGAGCCCAGACCTGCTCCATACCCACAAGCCATGGCATTTGCACCCCCAGATTGTGGCCCCCCTCCATATGATGCCAACCCCGGATACATTGCTCCAAATCCAGGTTTTTACCCTCCTCCTGGGCCTTATGTACCAATGGGCTATTACCCACCATCACCGAGCCAGTTCCAGCCTCCATACCCATCGCAGTACTCCTCTCCTGGGGCACAGGGCACCGCAGTAATTCTACCACCAGGGCCCACTTCTACCTCCGGCACTACCACCGTCACCTCCAACACCACCACAGTTACTGTGCTGCATGGGGAGATCTTCCAGGGGTCCCCGGTACAGACTGTGTGTCAGCACTGCCAGCAGCCAATCACCACTAAGATCTCCCATGAGATCGGCCTCATGAACTTCCTGCTCTGCTGCTTCTGCTGCTTTGTGGGGTGTGACCTGGGTTGTTGCCTCATTCCGTGTATAATTAATGACCTGAAGGATGTGACGCACACCTGTCCCAACTGCAAGGCTGTTATTTATACCTACAGGAGGATGTGCTT
Full Trace Sequence: CAATAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGAGTGACCCTCCCCCTCCTTACCCCGGGGGCCCATCGGCCCCACTGCTGGAGGACAAACATGGGGCTCCCAGAATGGAAGAGCCCAGACCTGCTCCATACCCACAAGCCATGGCATTTGCACCCCCAGATTGTGGCCCCCCTCCATATGATGCCAACCCCGGATACATTGCTCCAAATCCAGGTTTTTACCCTCCTCCTGGGCCTTATGTACCAATGGGCTATTACCCACCATCACCGAGCCAGTTCCAGCCTCCATACCCATCGCAGTACTCCTCTCCTGGGGCACAGGGCACCGCAGTAATTCTACCACCAGGGCCCACTTCTACCTCCGGCACTACCACCGTCACCTCCAACACCACCACAGTTACTGTGCTGCATGGGGAGATCTTCCAGGGGTCCCCGGTACAGACTGTGTGTCAGCACTGCCAGCAGCCAATCACCACTAAGATCTCCCATGAGATCGGCCTCATGAACTTCCTGCTCTGCTGCTTCTGCTGCTTTGTGGGGTGTGACCTGGGTTGTTGCCTCATTCCGTGTATAATTAATGACCTGAAGGATGTGACGCACACCTGTCCCAACTGCAAGGCTGTTATTTATACCTACAGGAGGATGTGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCATCCAGCTGATATCCCCTATAGTGGAGTCGTATAACATGGGACAAAAAACTAGTTTACTGGGCAACTCCGGCCCTGTCAAAAAAAATATTCCTCTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAGTGACCCTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ828950
dbEST ID: 79646652
Trimmed Sequence: GCACATCCTCCTGTAGGTATAAATAACAGCCTTGCAGTTGGGACAGGTGTGCGTCACATCCTTCAGGTCATTAATTATACACGGAATGAGGCAACAACCCAGGTCACACCCCACAAAGCAGCAGAAGCAGCAGAGCAGGAAGTTCATGAGGCCGATCTCATGGGAGATCTTAGTGGTGATTGGCTGCTGGCAGTGCTGACACACAGTCTGTACCGGGGACCCCTGGAAGATCTCCCCATGCAGCACAGTAACTGTGGTGGTGTTGGAGGTGACGGTGGTAGTGCCGGAGGTAGAAGTGGGCCCTGGTGGTAGAATTACTGCGGTGCCCTGTGCCCCAGGAGAGGAGTACTGCGATGGGTATGGAGGCTGGAACTGGCTCGGTGATGGTGGGTAATAGCCCATTGGTACATAAGGCCCAGGAGGAGGGTAAAAACCTGGATTTGGAGCAATGTATCCGGGGTTGGCATCATATGGAGGGGGGCCACAATCTGGGGGTGCAAATGCCATGGCTTGTGGGTATGGAGCAGGTCTGGGCTCTTCCATTCTGGGAGCCCCATGTTTGTCCTCCAGCAGTGGGGCCGATGGGCCCCCGGGGTAAGGAAGGGGGGAGGGTCACTCCGCCTTGGTGCCCAACTTTTTTTGTACAAAGTTGGGCAATATAAAAAAAGCAATGGCTCAACCAATTTGTTTGCAACCAAACAAGGTTCACTAATAAATTAAAAAAAAAAATTCAATTAGTTTTGGGGGCCCCGAACTTTAAGAAATGGGCCTCTTCCCG
Full Trace Sequence: ACGAGCAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCACATCCTCCTGTAGGTATAAATAACAGCCTTGCAGTTGGGACAGGTGTGCGTCACATCCTTCAGGTCATTAATTATACACGGAATGAGGCAACAACCCAGGTCACACCCCACAAAGCAGCAGAAGCAGCAGAGCAGGAAGTTCATGAGGCCGATCTCATGGGAGATCTTAGTGGTGATTGGCTGCTGGCAGTGCTGACACACAGTCTGTACCGGGGACCCCTGGAAGATCTCCCCATGCAGCACAGTAACTGTGGTGGTGTTGGAGGTGACGGTGGTAGTGCCGGAGGTAGAAGTGGGCCCTGGTGGTAGAATTACTGCGGTGCCCTGTGCCCCAGGAGAGGAGTACTGCGATGGGTATGGAGGCTGGAACTGGCTCGGTGATGGTGGGTAATAGCCCATTGGTACATAAGGCCCAGGAGGAGGGTAAAAACCTGGATTTGGAGCAATGTATCCGGGGTTGGCATCATATGGAGGGGGGCCACAATCTGGGGGTGCAAATGCCATGGCTTGTGGGTATGGAGCAGGTCTGGGCTCTTCCATTCTGGGAGCCCCATGTTTGTCCTCCAGCAGTGGGGCCGATGGGCCCCCGGGGTAAGGAAGGGGGGAGGGTCACTCCGCCTTGGTGCCCAACTTTTTTTGTACAAAGTTGGGCAATATAAAAAAAGCAATGGCTCAACCAATTTGTTTGCAACCAAACAAGGTTCACTAATAAATTAAAAAAAAAAATTCAATTAGTTTTGGGGGCCCCGAACTTTAAGAAATGGGCCTCTTCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACATCCTCCTGTAGGTATAA