ORFeome > cdk1 ORF1 – XORFeome v1.0

cdk1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cdk1
Gene ID: 6254942
Gene Page ID: 482749
ORF Xenbase ID: 17268765

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054146
Original XGC clone length: 909

Human orthology & disease relationships

NCBI Entrez ID: 983
Ensembl gene IDs: ENSG00000170312
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,120435,151623,158320,172800,227650,259500,275355,606843,608089,609048

Library Location

Plate ID: GDExl11002
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ839265
dbEST ID: 79656967
Trimmed Sequence: ATGGACGAGTACACTAAAATAGAGAAGATTGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCTCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCGACAATGAAGTGTGGCCAGAAGTAAAGTCTTTACAAGATTACAAGAACACATTTCCCCAAATGGAAAAGGGGGGAAGCCTGGTCGTTCGAAAGTGTGAAAAATAATTGAATAAAAGAAGGGG
Full Trace Sequence: GCTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGAGTACACTAAAATAGAGAAGATTGGAGAGGGCACATATGGGGTCGTGTACAAGGGTCGTCACAAAGCAACCGGCCAGGTCGTCGCAATGAAGAAAATTAGATTGGAAAATGAAGAGGAAGGTGTCCCAAGTACAGCAATCCGAGAAATATCACTACTTAAAGAGCTTCAGCACCCCAACATAGTCTGCCTCCTAGATGTCCTCATGCAAGACTCAAGGTTGTATCTTATCTTTGAGTTTCTCTCCATGGATCTAAAGAAGTATTTAGACTCGATACCCAGCGGCCAGTATATCGATACAATGCTCGTTAAGAGTTACCTGTACCAGATCCTACAAGGGATTGTATTCTGTCACTCCAGACGAGTTCTACACAGAGACCTGAAACCTCAAAACCTGCTCATAGACAATAAAGGAGTGATAAAGTTGGCAGATTTTGGCCTTGCCAGAGCTTTTGGAATTCCGGTTCGGGTTTACACACACGAGGTCGTGACGTTATGGTACAGAGCCTCGGAAGTGCTGTTGGGGTCAGTCCGATATTCAACGCCAGTTGACGTCTGGAGCGTAGGAACTATTTTCGCCGAGATCGCCACAAAGAAACCCCTCTTCCACGGTGACTCTGAAATTGACCAGCTCTTCAGGATATTCAGATCTTTAGGGACACCCGACAATGAAGTGTGGCCAGAAGTAAAGTCTTTACAAGATTACAAGAACACATTTCCCCAAATGGAAAAGGGGGGAAGCCTGGTCGTTCGAAAGTGTGAAAAATAATTGAATAAAAGAAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGAGTACACTAAAATAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839264
dbEST ID: 79656966
Trimmed Sequence: ATTTCTAATCTGATTGGCGGGAAGGCTGGACTTATCCAAGTCATCGAAGTAGGGGTGCAACATAGCTTTTCGTGCGGAAATCCTCTTGGCGGGATCATAGACTAGCATTTTAGACAGCAGGTCCAGCCCATCCTCATCAATATTTTTCACATTCGACGACAGGCTTCCCCCTTTCCATTTGGGGAATGTGTTCTTGTAATCTTGTAAAGACTCTACTTCTGGCCACACTTCATTGTTGGGTGTCCCTAAAGATCTGAATATCCTGAAGAGCTGGTCAATTTCAGAGTCACCGTGGAAGAGGGGTTTCTTTGTGGCGATCTCGGCGAAAATAGTTCCTACGCTCCAGACGTCAACTGGCGTTGAATATCGGACTGACCCCAACAGCACTTCCGAGGCTCTGTACCATAACGTCACGACCTCGTGTGTGTAAACCCGAACCGGAATTCCAAAAGCTCTGGCAAGGCCAAAATCTGCCAACTTTATCACTCCTTTATTGTCTATGAGCAGGTTTTGAGGTTTCAGGTCTCTGTGTAGAACTCGTCTGGAGTGACAGAATACAATCCCTTGTAGGATCTGGTACAGGTAACTCTTAACGAGCATTGTATCGATATACTGGCCCGCTGGGTAACCAGTCTAAATACTTCCTTAGATTCATGGAAAAAAAACTCAAAAAAAAAAATACCAACCTTGAATTCTTTGCATGGAGGACATCCTAGGAAAGGACAAACTAGGGTTTGGGGGTGTTTGAAACCCTTTTTTAAT
Full Trace Sequence: GCACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTTCTAATCTGATTGGCGGGAAGGCTGGACTTATCCAAGTCATCGAAGTAGGGGTGCAACATAGCTTTTCGTGCGGAAATCCTCTTGGCGGGATCATAGACTAGCATTTTAGACAGCAGGTCCAGCCCATCCTCATCAATATTTTTCACATTCGACGACAGGCTTCCCCCTTTCCATTTGGGGAATGTGTTCTTGTAATCTTGTAAAGACTCTACTTCTGGCCACACTTCATTGTTGGGTGTCCCTAAAGATCTGAATATCCTGAAGAGCTGGTCAATTTCAGAGTCACCGTGGAAGAGGGGTTTCTTTGTGGCGATCTCGGCGAAAATAGTTCCTACGCTCCAGACGTCAACTGGCGTTGAATATCGGACTGACCCCAACAGCACTTCCGAGGCTCTGTACCATAACGTCACGACCTCGTGTGTGTAAACCCGAACCGGAATTCCAAAAGCTCTGGCAAGGCCAAAATCTGCCAACTTTATCACTCCTTTATTGTCTATGAGCAGGTTTTGAGGTTTCAGGTCTCTGTGTAGAACTCGTCTGGAGTGACAGAATACAATCCCTTGTAGGATCTGGTACAGGTAACTCTTAACGAGCATTGTATCGATATACTGGCCCGCTGGGTAACCAGTCTAAATACTTCCTTAGATTCATGGAAAAAAAACTCAAAAAAAAAAATACCAACCTTGAATTCTTTGCATGGAGGACATCCTAGGAAAGGACAAACTAGGGTTTGGGGGTGTTTGAAACCCTTTTTTAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTCTAATCTGATTGGCGGG