ORFeome > cdk10 ORF1 – XORFeome v1.0

cdk10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk10
Gene ID: 5727048
Gene Page ID: 5727030
ORF Xenbase ID: 17268777

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129670
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ838637
dbEST ID: 79656339
Trimmed Sequence: ATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAATTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCGACCTGCTCGTGACTGATAAAGGCTGTGTGAGGATCGCTGACTTTGGCCTGGCTCCTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGAACTCATGGTACCGGGGCCCGGAACTTTTCCTGGAAAGCACTACGCTAACAAAGCTTATGAACATGTGGGCGGTTGGTTCAGTCGGGGTGAACTCCTGGCTTACCGGCCCCTTCCTTCAGGAATATTCAAAAAATCCAACAAAATAGTTTTGAATTTAATACATCTGCCTTTGCCCACCCCT
Full Trace Sequence: TCGGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCGGCTTTTGTTGGAGAAAATCGGGACTGTTGGGCGATATGGAGGAAGACAGACTTGGTCGCTGCCGAAGTGTTAAGGAATTTGAGAAATTAAATCGCATTGGTGAAGGAACTTATGGTATAGTATATCGTGCCAGAGATACGAAGAGCAATGAAATAGTTGCACTGAAGAAGGTGAGAATGGACAAAGAGAAAGATGGTATCCCCATAAGCAGCCTACGGGAGATAACTCTCCTACTTAAATTGCGACATCCCAACATTGTGGAGCTGAAGGAAGTAGTTGTTGGAAATCACCTAGAAAGTATCTTTCTGGTTATGGGATACTGTGAACAAGACCTGGCCAGTCTTCTGGAGAATATGCAAACCCCATTCTCAGAAGCCCAGGTGAAATGCATCTGCTTCCAGCTCCTCACTGGGCTTCAGTATCTCCATGAGAGCTTTATAGTGCATAGAGATCTGAAGGTATCCGACCTGCTCGTGACTGATAAAGGCTGTGTGAGGATCGCTGACTTTGGCCTGGCTCCTGCTTTTAGCACCCCTGCAAAGCAGATGACTCCTAAAGTGGTGAACTCATGGTACCGGGGCCCGGAACTTTTCCTGGAAAGCACTACGCTAACAAAGCTTATGAACATGTGGGCGGTTGGTTCAGTCGGGGTGAACTCCTGGCTTACCGGCCCCTTCCTTCAGGAATATTCAAAAAATCCAACAAAATAGTTTTGAATTTAATACATCTGCCTTTGCCCACCCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCGGCTTTTGTTGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838636
dbEST ID: 79656338
Trimmed Sequence: TGGTTTGCTGCGCTTGCACTGGCTCTCTGCTCCTGTGCCACTTGCTCTCTTGTTCCGATGATGTGGGAATGTAGGCATCAGCTGGGGTTCACAGGGCAAAGGCTTTTCCTTAAAATATGAACTTGCAAGACTGTCCTCAGCTGTTGCTCTCTTTTTGGGGTCATACATAAAAAGAAAATTAAGTAAGCGAAGTCCAGCTTCAGACAACCAGGGAAACTTGTGTTTTAAATTGTTGTAAGGCTGCTTACGTACGGTGTATTGACCAACTAAAGGCAGCTTTGAGAAGCCTGGCCAAATGTTTTCATTAGGTGTGCCAAGCAGCTGTATAATCAAATCAATCTGCTGGATTTCTGAACTTCCTGGAAGAAGCGGCTTGTGAGCCAGGAGCTCAGCCAGTATGCAACCAACAACCCACATGTCTATAGCTGTTGTCTGTGTAGTGCTTCCCAGGAGAAATTCAAGGGCCCGGTACCATACAGTCACCACTTTATGAATCATCTGCTTTGCAGGGGTGCTGAAAGCACGAGCCAGCCCAAGTCAGCGATCTTTCCACAGCCCTTATCGTTCATAAACAAGTTGGAAACCTTCAGATCCCATCCGCTATAGGGCTCTCAAGGAGATACTGAAGGCCCACTGACGAGCTGGAAGCGGAAGAAATTACACATACCCTTTTAAAAGTGAGATTGGCGTGTTGGGGCGAAAAAACTAACAATAAAAACATATTCCGCTGGGTCTCCCTTTCCCCGGGGGGGCATACCTT
Full Trace Sequence: GAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGGTTTGCTGCGCTTGCACTGGCTCTCTGCTCCTGTGCCACTTGCTCTCTTGTTCCGATGATGTGGGAATGTAGGCATCAGCTGGGGTTCACAGGGCAAAGGCTTTTCCTTAAAATATGAACTTGCAAGACTGTCCTCAGCTGTTGCTCTCTTTTTGGGGTCATACATAAAAAGAAAATTAAGTAAGCGAAGTCCAGCTTCAGACAACCAGGGAAACTTGTGTTTTAAATTGTTGTAAGGCTGCTTACGTACGGTGTATTGACCAACTAAAGGCAGCTTTGAGAAGCCTGGCCAAATGTTTTCATTAGGTGTGCCAAGCAGCTGTATAATCAAATCAATCTGCTGGATTTCTGAACTTCCTGGAAGAAGCGGCTTGTGAGCCAGGAGCTCAGCCAGTATGCAACCAACAACCCACATGTCTATAGCTGTTGTCTGTGTAGTGCTTCCCAGGAGAAATTCAAGGGCCCGGTACCATACAGTCACCACTTTATGAATCATCTGCTTTGCAGGGGTGCTGAAAGCACGAGCCAGCCCAAGTCAGCGATCTTTCCACAGCCCTTATCGTTCATAAACAAGTTGGAAACCTTCAGATCCCATCCGCTATAGGGCTCTCAAGGAGATACTGAAGGCCCACTGACGAGCTGGAAGCGGAAGAAATTACACATACCCTTTTAAAAGTGAGATTGGCGTGTTGGGGCGAAAAAACTAACAATAAAAACATATTCCGCTGGGTCTCCCTTTCCCCGGGGGGGCATACCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTTTGCTGCGCTTGCACT