ORFeome > cdk2 ORF1 – XORFeome v1.0

cdk2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk2
Gene ID: 1001995
Gene Page ID: 1001989
ORF Xenbase ID: 17268813

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106636
Original XGC clone length: 894

Human orthology & disease relationships

NCBI Entrez ID: 1017
Ensembl gene IDs: ENSG00000123374
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,151623,174900,175050,194050,216400,223100,259500,260350,277700,278300,278780,608089,609048,609192

Library Location

Plate ID: GDExl11085
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ837692
dbEST ID: 79655394
Trimmed Sequence: ATGGAGAATTTCCAGAAGGTGGAGAAGATCGGGGAGGGCACGTACGGGGTGGTGTACAAGGCTCGGAACAGAGAGACCGGGGAAATTGTGGCTCTGAAAAAGATACGCTTGGACACTGAGACAGAAGGAGTTCCAAGCACAGCCATCCGGGAAATTTCCCTCCTCAAAGAACTGAACCATCCCAACATTGTGAAGCTTCTTGATGTCATTCATACGGAAAACAAGCTCTACCTTGTCTTCGAATTCCTTAACCAAGATCTGAAGAAATTCATGGACGGTTCAAACATTTCTGGAATTTCATTGGCCCTAGTTAAAAGCTATCTGTTCCAGTTGCTTCAAGGTTTGGCTTTCTGCCACTCACATCGTGTCTTACATCGTGATCTAAAACCACAGAACCTGCTTATTAATTCTGATGGAGCCATCAAACTTGCCGACTTTGGACTAGCTCGGGCATTTGGTGTGCCTGTGAGAACCTTCACTCATGAGGTTGTCACTCTGTGGTACAGAGCACCAGAAATCCTTCTTGGCTGCAAGTTCTACTCTACGGCTGTAGATATCTGGAGCCTGGGATGTATTTTTGCTGAAATTGATCACAGGGAGAGCGCTTTTTTCCGGAAATTCTGAAATTGATCAGCCTTTTCGTATTCTTTGAACACTTGGGACCCCCGCATGAAATGTCCTGGCCGGGGGGCCCAGACTATCCCAAATTACAATTCACCTTTTCCTCTTT
Full Trace Sequence: CGAGGGCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAATTTCCAGAAGGTGGAGAAGATCGGGGAGGGCACGTACGGGGTGGTGTACAAGGCTCGGAACAGAGAGACCGGGGAAATTGTGGCTCTGAAAAAGATACGCTTGGACACTGAGACAGAAGGAGTTCCAAGCACAGCCATCCGGGAAATTTCCCTCCTCAAAGAACTGAACCATCCCAACATTGTGAAGCTTCTTGATGTCATTCATACGGAAAACAAGCTCTACCTTGTCTTCGAATTCCTTAACCAAGATCTGAAGAAATTCATGGACGGTTCAAACATTTCTGGAATTTCATTGGCCCTAGTTAAAAGCTATCTGTTCCAGTTGCTTCAAGGTTTGGCTTTCTGCCACTCACATCGTGTCTTACATCGTGATCTAAAACCACAGAACCTGCTTATTAATTCTGATGGAGCCATCAAACTTGCCGACTTTGGACTAGCTCGGGCATTTGGTGTGCCTGTGAGAACCTTCACTCATGAGGTTGTCACTCTGTGGTACAGAGCACCAGAAATCCTTCTTGGCTGCAAGTTCTACTCTACGGCTGTAGATATCTGGAGCCTGGGATGTATTTTTGCTGAAATTGATCACAGGGAGAGCGCTTTTTTCCGGAAATTCTGAAATTGATCAGCCTTTTCGTATTCTTTGAACACTTGGGACCCCCGCATGAAATGTCCTGGCCGGGGGGCCCAGACTATCCCAAATTACAATTCACCTTTTCCTCTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAATTTCCAGAAGGTGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837691
dbEST ID: 79655393
Trimmed Sequence: AATCAGATGTGGAGTAGGTCTGCTCACATCTCGGAAGAAAGGATGGGTCAGCGCTACTTTAGCAGAAATCCGTTTGTTGGAGTCATACTGAAGCATTTGAGCTAAAAGATCTCTACCATCCTCATCCAAAGGTGGTACCACTTTGCTAAAGTCCTGTCGGATCCACTTGGGAAAGGTTGACTTGTAATCTGGCATAGTTGTGACTCCTGGCCAGGACACTTCATCAGGGGTCCCCAGTGTTCGAAAGATACGAAAAAGCTGATCAATTTCAGAATCTCCTGGAAAAAGCGCTCTCCTGGTGATCATTTCAGCAAAAATACATCCCAGGCTCCAGATATCTACAGCCGTAGAGTAGAACTTGCAGCCAAGAAGGATTTCTGGTGCTCTGTACCACAGAGTGACAACCTCATGAGTGAAGGTTCTCACAAGCACACCAAATGCCCGAGCTAGTCCAAAGTCGGCAAGTTTGATGGCTCCATCAGAATTAATAAGCAGGTTCTGTGGGTGTATATCACGATGTAAGACACGATGTGAGTGGCGGAGAGCCAAACCTTGAAGCACCTGGAACGAATAACTTTTAAATAAGGCGGAGGAAATTCCAGAAATGGGTGAGCGGGGGTGAGTTTCGTCATATCTTGGTGAGGGAGTTGGAATACAAAGTAAAGGTTGTTTTCCGTATGAGTGAAAAGCGGAAGCGGGAGGATGTGGGGAGGGTGGAGGGGTGGGGACGAGGGAGGGTGACCAGAGGGGTGGGGGGGGGAAGTCATTACTGGTGGGGGGGAGGGGGGAGCGTGGAAAAGAACCAAGAGGGCCCGTGCCCGGGGGGGCGAGGGGAGAGGGGGGGGGGAGAAGGGGGGGGGGGGGGAGGGTGGGAGATGAGGAGGGATGAGAAAGCGGCGGGGGGGTTTCGGTAGGGGGGGGGAAGAGAAGGAGGAGGGAGGGGGGGGGGGGAGGGGGGGGGGAGGGGGAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGGAAGAATACAAAGAGCCCAAAAACAAGAAAAGGGCGGCGGCCCGGGCAGAGCCGCGGGTTGTGGTGTGTTATCCGCGCGCGGGGAAGAGGAGGAGAAAAGGCGGAAAACGGGAGGGGAAAACGCAGCGGCGGGTGGGGTGTTGAAGAGAGTGGGAGGAAGAGGGGAAAAACCAGAGAAGGGAGCGGCGACGACGGCA
Full Trace Sequence: GGGCAGGGGAACAGCTTATGACCATGTAATACGACTCACTACTAGGGGATATCAGCTTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAATCAGATGTGGAGTAGGTCTGCTCACATCTCGGAAGAAAGGATGGGTCAGCGCTACTTTAGCAGAAATCCGTTTGTTGGAGTCATACTGAAGCATTTGAGCTAAAAGATCTCTACCATCCTCATCCAAAGGTGGTACCACTTTGCTAAAGTCCTGTCGGATCCACTTGGGAAAGGTTGACTTGTAATCTGGCATAGTTGTGACTCCTGGCCAGGACACTTCATCAGGGGTCCCCAGTGTTCGAAAGATACGAAAAAGCTGATCAATTTCAGAATCTCCTGGAAAAAGCGCTCTCCTGGTGATCATTTCAGCAAAAATACATCCCAGGCTCCAGATATCTACAGCCGTAGAGTAGAACTTGCAGCCAAGAAGGATTTCTGGTGCTCTGTACCACAGAGTGACAACCTCATGAGTGAAGGTTCTCACAAGCACACCAAATGCCCGAGCTAGTCCAAAGTCGGCAAGTTTGATGGCTCCATCAGAATTAATAAGCAGGTTCTGTGGGTGTATATCACGATGTAAGACACGATGTGAGTGGCGGAGAGCCAAACCTTGAAGCACCTGGAACGAATAACTTTTAAATAAGGCGGAGGAAATTCCAGAAATGGGTGAGCGGGGGTGAGTTTCGTCATATCTTGGTGAGGGAGTTGGAATACAAAGTAAAGGTTGTTTTCCGTATGAGTGAAAAGCGGAAGCGGGAGGATGTGGGGAGGGTGGAGGGGTGGGGACGAGGGAGGGTGACCAGAGGGGTGGGGGGGGGAAGTCATTACTGGTGGGGGGGAGGGGGGAGCGTGGAAAAGAACCAAGAGGGCCCGTGCCCGGGGGGGCGAGGGGAGAGGGGGGGGGGAGAAGGGGGGGGGGGGGGAGGGTGGGAGATGAGGAGGGATGAGAAAGCGGCGGGGGGGTTTCGGTAGGGGGGGGGAAGAGAAGGAGGAGGGAGGGGGGGGGGGGAGGGGGGGGGGAGGGGGAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAGAAGGAAGAATACAAAGAGCCCAAAAACAAGAAAAGGGCGGCGGCCCGGGCAGAGCCGCGGGTTGTGGTGTGTTATCCGCGCGCGGGGAAGAGGAGGAGAAAAGGCGGAAAACGGGAGGGGAAAACGCAGCGGCGGGTGGGGTGTTGAAGAGAGTGGGAGGAAGAGGGGAAAAACCAGAGAAGGGAGCGGCGACGACGGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAATCAGATGTGGAGTAGGTC