ORFeome > cdk2ap1 ORF1 – XORFeome v1.0

cdk2ap1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cdk2ap1
Gene ID: 5715250
Gene Page ID: 5715099
ORF Xenbase ID: 17268825

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC054285
Original XGC clone length: 351

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: A02

Sequences - 5ʹ (forward) EST

Accession: JZ839267
dbEST ID: 79656969
Trimmed Sequence: ATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCTCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTT
Full Trace Sequence: CTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTTACAAGCCCAACCCGAACGCGCAGCACCCCGCCAGTAACCCCGGCTTGCAGGCTGGGAGTGCCCATTCCCCTTCAACAAGTATGGTATCGACTGCACAATACAGGCAGCTAGTTAATGACTATGGACCTCCATCTTTAGGATATGCTCAGGTTTCTAATAGTAATCAGGTTCCTCAGAGCAAGTATGCAGAACTTCTTTCCATCATTGAAGAGCTGGGTAAAGAAATTAGACCAACATATGCTGGCAGTAAAAGTGCTATGGAGAGATTTAAAAGAGGTATCATCCACGCTAGGGGCTTGGTCCGGGAATGTTTGGCCGAAACAGAGCGTAATGCAAGATCCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCAAAAAATAAAAAAAAAAAACAAAAAAAAAAAAAAACCAGTAAAAAGCAAGGAAAAAAAAAAAAAAAAAAAAAAAAAATACCAAAAAGCCCTTGTTTAAAACCGAGAGAGGGAAAAAAAGGCCACACCCACCCGGACACAACACGGGGCTGCGGGGGGAGACCCACAAAGTGAAAAGAAGAGAGAGGGGGGGCCAAACCCCCCACAGGAAACACAACCCCCGTGGTTCGAGGGGGGAGAAGGGGGAGGGTGGGGTGTGGTTTGGGTTTTATATCCCTTTTTTTGAGAGGGAGGGGGGGAGAAAAAGAAAAAACTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTTACAAGCCCAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839266
dbEST ID: 79656968
Trimmed Sequence: GGATCTTGCATTACGCTCTGTTTCGGCCAAACATTCCCGGACCAAGCCCCTAGCGTGGATGATACCTCTTTTAAATCTCTCCATAGCACTTTTACTGCCAGCATATGTTGGTCTAATTTCTTTACCCAGCTCTTCAATGATGGAAAGAAGTTCTGCATACTTGCTCTGAGGAACCTGATTACTATAAGAAACCTGAGCATATCCTAAAGATGGAGGTCCATAGTCATTAACTAGCTGCCTGTATTGTGCAGTCAATACCATACTTGTTGAAGGGGAATGGGCACTCCCAGCCTGCAAGCCGGGGTTACTGGCGGGGTGCTGCGCGTTCGGGTTGGGCTTGTAAGACATGG
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAAACAATGCTTTCTTATAATGCCAACTTTGTACAAAAAAGTTGGCAAGGATCTTGCATTACGCTCTGTTTCGGCCAAACATTCCCGGACCAAGCCCCTAGCGTGGATGATACCTCTTTTAAATCTCTCCATAGCACTTTTACTGCCAGCATATGTTGGTCTAATTTCTTTACCCAGCTCTTCAATGATGGAAAGAAGTTCTGCATACTTGCTCTGAGGAACCTGATTACTATAAGAAACCTGAGCATATCCTAAAGATGGAGGTCCATAGTCATTAACTAGCTGCCTGTATTGTGCAGTCAATACCATACTTGTTGAAGGGGAATGGGCACTCCCAGCCTGCAAGCCGGGGTTACTGGCGGGGTGCTGCGCGTTCGGGTTGGGCTTGTAAGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCATCATTTTGATGCAACGAACAGGTCACTATCAGTCAAAAAAAAATCATTATTTGCGGCCCAAGCCTAAGACTGACCAAAAAAAAAAAAAAAACGAGACAGAGCAACTTGAACACACCGTCTGGGGGTGTGTGTAAAACAAACAAAACTTCAATACGGTGTCCGGAGCCGGGGGTTTGGGTATGGCCCGGAAGCGGGGAAAAACACACCGGGATAGCCGGCCCCCTTATTGGGGCTGGCTGGGGACCCTTAAGTATGAGAAGCGGCCGGAGACAGGCGTGGGGGTAGGGAGGACGAGCATGTAGAAAAGAATCTAGTTTTGTTGCCGGGGTTTGAAGAAAAGTAAATGTGTAGCTTCACCGGAGTTCGNCACAAAGGGGGAGAGCCACCCCGTGTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATCTTGCATTACGCTCT