ORFeome > cdk4 ORF1 – XORFeome v1.0

cdk4 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk4
Gene ID: 5900736
Gene Page ID: 5900654
ORF Xenbase ID: 17268837

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC051599
Original XGC clone length: 960

Human orthology & disease relationships

NCBI Entrez ID: 1019
Ensembl gene IDs: ENSG00000135446,LRG_490
Directly associated (OMIM) disease MIM numbers: 609048
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,151623,155601,174900,175050,259500,260350,606719,608089,609048,609192

Library Location

Plate ID: GDExl11012
Well Location: F10

Sequences - 5ʹ (forward) EST

Accession: JZ824006
dbEST ID: 79641708
Trimmed Sequence: 0
Full Trace Sequence: ATTATTGATTTTATTTTTGACTGATAGTGACTCGTTCTTTGGGCCAATTGATGTATCCTGCTTGCTCTAGGACGCCGTCTTTGATTCTCAAATTTGGCACCATGTCAAAAGAAATGAAGGGTCAATATGAACCTGTCGCAGAGATTGGCGTCGGGGCTTACGGCACGGTATACAAGGCCAGGGACCTTCAAAGTGGAAAGTTTGTTGCCCTCAAAAATGTGCGGGTGCAAACCAACGAGAATGGACTCCCCCTCTCTACGGTCAGGGAAGTGGCTTTATTGAAACGCCTGGAGCATTTTGACCATCCAAACATTGTAAAACTTATGGATGTTTGTGCTTCTGCCCGAACTGACCGAGAGACTAAAGTGACGCTGGTGTTTGAACATGTGGACCAAGACCTGAAGACTTACTTGAGCAAAGTCCCACCTCCAGGTCTTCCACTGGAGACTATTAAGGACCTCATGAAGCAGTTCCTTTCGGGCCTGGAATTCCTCCATTTGAATTGCATTGTGCACCGAGACCTTAAACCTGAGAATATCTTGGTGACAAGTGGGGGACAGGTGAAACTTGCCGACTTTGGCCTAGCGAGGATATACAGCTGTCAGATGGCTCTCACGCCCGTGGTGGTGACGTTGTGGTACAGGGCCCCAGAAGTCCTGCTTCAGTCCACGTATGCCACGCCGGTAGATGTGTGGAGCGCGGGCTGCATCTTCGCAGAGATGTTCAAGCGAAAACCCCTGTTCTGCGGCATTCAGAAGCTGACCAGTTGTGCAAGATATTTGATATTATTGGGCTTCCTTCTGAAAGAGAGTGGCCCGNTGGATGTTACTTTTGCACGGTTCTTGCCTTTTCCCCGAAGACTCACCACCAAGTGGGACAAAATTTGGTGCCGGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAAAAGAAATGAAGGGTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829314
dbEST ID: 79647016
Trimmed Sequence: TTTCACTTCATCCGTTGCGGTGCAGATATGAGTAAAGTGTTCTTGTTTGGAGCAGGCCTGGGGATCGTCAGCGAAAAAGGGGTGGAGCAGAGCATCGGAGGCGGAAATACGTTTTTGAGGGCTGAAGGTCAGCATGGCCAGAAGAAGATCCGCTCCCATGGCATCGATTTCCGGCACAAACTTGTCCACTGGCTGCTGAGTCCTCGGGGAAAAGGCAGAACGTGGCAAAGTAACATCCACCGGCCACTCCTCTTCAGAAGGAAGCCCAATAATATCAAATATCTTGCACAACTGGTCAGCTTCTGAATTGCCGCAGAACAGGGGTTTTCGCTTGAACATCTCTGCGAAGATGCAGCCCGCGCTCCACACATCTACCGGCGTGGCATACGTGGACTGAAGCAGGACTTCTGGGGCCCTGTACCACAACGTCACCACCACGGGCGTGAGAGCCATCTGACAGCTGTATATCCTCGCTAGGCCAAAGTCGGCAAGTTTCACCTGTCCCCCACTTGTCACCAAGATATTCTCAGGTTTAAGGTCTCGGTGCACAATGCAATTCAAAAGGGAGGAATTCCAGGCCCCGAAGGGAACTGCTTCATGAAGGTCCTTAATAGTCTTCAGTGGGAAAACCTGGAAGGTGGGAACTTTGCTTCAAGTTAAGTCTTTCAGGGTTCTTGGTTCCACAAGGTTCAAAACACCCAGCGGTCACTTTTTGTTCTCCTGGGGTTCCAGTTTCCGGGCGAGAAAACCCAAAAAACAATTCCCT
Full Trace Sequence: CGGCAGGAAGCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAGAGGGTGATATTATTTTAGACGGATGGTGATTTGTTCGTCGTGACTGGGAATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCACTTCATCCGTTGCGGTGCAGATATGAGTAAAGTGTTCTTGTTTGGAGCAGGCCTGGGGATCGTCAGCGAAAAAGGGGTGGAGCAGAGCATCGGAGGCGGAAATACGTTTTTGAGGGCTGAAGGTCAGCATGGCCAGAAGAAGATCCGCTCCCATGGCATCGATTTCCGGCACAAACTTGTCCACTGGCTGCTGAGTCCTCGGGGAAAAGGCAGAACGTGGCAAAGTAACATCCACCGGCCACTCCTCTTCAGAAGGAAGCCCAATAATATCAAATATCTTGCACAACTGGTCAGCTTCTGAATTGCCGCAGAACAGGGGTTTTCGCTTGAACATCTCTGCGAAGATGCAGCCCGCGCTCCACACATCTACCGGCGTGGCATACGTGGACTGAAGCAGGACTTCTGGGGCCCTGTACCACAACGTCACCACCACGGGCGTGAGAGCCATCTGACAGCTGTATATCCTCGCTAGGCCAAAGTCGGCAAGTTTCACCTGTCCCCCACTTGTCACCAAGATATTCTCAGGTTTAAGGTCTCGGTGCACAATGCAATTCAAAAGGGAGGAATTCCAGGCCCCGAAGGGAACTGCTTCATGAAGGTCCTTAATAGTCTTCAGTGGGAAAACCTGGAAGGTGGGAACTTTGCTTCAAGTTAAGTCTTTCAGGGTTCTTGGTTCCACAAGGTTCAAAACACCCAGCGGTCACTTTTTGTTCTCCTGGGGTTCCAGTTTCCGGGCGAGAAAACCCAAAAAACAATTCCCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCACTTCATCCGTTGCG