ORFeome > cdk5rap1 ORF1 – XORFeome v1.0

cdk5rap1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk5rap1
Gene ID: 5727621
Gene Page ID: 5727594
ORF Xenbase ID: 17268855

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123344
Original XGC clone length: 1698

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ837394
dbEST ID: 79655096
Trimmed Sequence: ATGAAGTACTTCAGGCTATTTTCCAGAGCTAGGCTTTGGCCGTGCCATAGGTGTGTTTTTTCTACTGCTTCCGGTACTAGAGAAACGCTAAAGAAAAAAGAGGAATTAATTTCAAGATTATCAACTGGGCCACAACTGAAAGACTTTTTCGTCAACACCAAACCTGCTAAAACAGTATCCCCAGCTGACGATGATGATCCTCCTCCTTATATTACACCTTTATATCCACCGTCACAGAATAACAAAATATATTTGGAGACCTATGGCTGCCAGATGAATGTTAATGATACAGAGATTGCCTGGTCCATTTTGCAACAGAACGGTTATGTCCGAACACACATAGAGACCGAGGCTGATGTGATCTTCTTGGTTACTTGCTCAGTCAGGGAAAAGGCAGAGCAGACAATATGGAACAGACTACAGCAGTTTGCCACGCTAAAGCGAAAAAGGAGCAAAGACAACAGGATGAGGATTGGAATATTAGGTTGCATGGCAGAAAGGTTGAAACAAGAGATTTTGGAAAGAGAAAATCTTGTGGACATAGTTGCTGGTCCAGATGCCTACCGAGATCTCCCGAGACTACTTGCAGTGGCAGAGAGTGGACAGCAGGTGGCTAATGTGCTCCCTTTCTGTGGATGAAACCTATGCAGACATCATGCCAGTTCATACATCAGCCAGCAGCAAATCTGCCTTTTGTCTCTCCAATGCGTGGCTGTGACGACATGTGCACCTACGGTATCGTTCCATTCACCCGTGGGCCGTGAGAAGAGTCCCCCCTTTCTTTTCCATCCTAAAAAAAAATTCCAAAGGCCTTTCTAACCC
Full Trace Sequence: CGTGGGCCCATATAAGTGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGTACTTCAGGCTATTTTCCAGAGCTAGGCTTTGGCCGTGCCATAGGTGTGTTTTTTCTACTGCTTCCGGTACTAGAGAAACGCTAAAGAAAAAAGAGGAATTAATTTCAAGATTATCAACTGGGCCACAACTGAAAGACTTTTTCGTCAACACCAAACCTGCTAAAACAGTATCCCCAGCTGACGATGATGATCCTCCTCCTTATATTACACCTTTATATCCACCGTCACAGAATAACAAAATATATTTGGAGACCTATGGCTGCCAGATGAATGTTAATGATACAGAGATTGCCTGGTCCATTTTGCAACAGAACGGTTATGTCCGAACACACATAGAGACCGAGGCTGATGTGATCTTCTTGGTTACTTGCTCAGTCAGGGAAAAGGCAGAGCAGACAATATGGAACAGACTACAGCAGTTTGCCACGCTAAAGCGAAAAAGGAGCAAAGACAACAGGATGAGGATTGGAATATTAGGTTGCATGGCAGAAAGGTTGAAACAAGAGATTTTGGAAAGAGAAAATCTTGTGGACATAGTTGCTGGTCCAGATGCCTACCGAGATCTCCCGAGACTACTTGCAGTGGCAGAGAGTGGACAGCAGGTGGCTAATGTGCTCCCTTTCTGTGGATGAAACCTATGCAGACATCATGCCAGTTCATACATCAGCCAGCAGCAAATCTGCCTTTTGTCTCTCCAATGCGTGGCTGTGACGACATGTGCACCTACGGTATCGTTCCATTCACCCGTGGGCCGTGAGAAGAGTCCCCCCTTTCTTTTCCATCCTAAAAAAAAATTCCAAAGGCCTTTCTAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGTACTTCAGGCTATTTTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837393
dbEST ID: 79655095
Trimmed Sequence: GCTGTAAGCAGGAGACTTCTGGAGGGTGGTCAGGCCGAGCAGAGTCCCTTTTAAACTCTGGGAGCTGGAAGATGTTATCTTCACCAAGACATAATCTCCAGGTTGGATTTTATTCTCCAGTGCTAAGTTATCTGCTTTTGGTGTTTCAGAGAATATTACTTTAGTATTTCCATCGTTCCTGCCACACAGTTCTGCTGGAGAACGTTTACTTGGCCCTTCTACCAGCACCAGCTGGGTACTTCCCACAGTTCTCTGATTCACTCTTCCAGCCTCCTCTCTGAAGACAGAAATGAGCTCCTCCAACCGCCGTTGTTTTACCTCTGGGGGAACATCATCCTGCAGTCTATGATATGCCCTTGTTTTCTTTCTCATGCTGTAGGCGAACAGATAGGCTGCATTATAGGAAACCTCCCGTAAGAGCGACAAAGTTTGCTGATGATCCTCCTCTGTCTCCTGGCAGAAGCCCGTAATGAAATCACTGCTGAGACTCACACCTGGAATGGATTCCCGAATATTCTGAATCAGATCCAGATAAGCTTCTCTGCTGTACCCTCTTCTCATGCTCTCCAGAACTCTATTACTTCCACTCTGAGCCGGGGATGTGGATTTGTTTTGCAATGTTGTGACGTTCAGCAATTACCTGGAGAACGTCGTCCTGGAAATCTTTGGGGAAGGGGGAGAAGTAAAACGAAAATCTCATTTTCAGGGTCAATCTTAAAAAGAGTTTAACCCGGGGAAAACTTACAAACCCTCAAGGCCCCCCCTTTTTTTTTTTCC
Full Trace Sequence: AAAACCGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTAAGCAGGAGACTTCTGGAGGGTGGTCAGGCCGAGCAGAGTCCCTTTTAAACTCTGGGAGCTGGAAGATGTTATCTTCACCAAGACATAATCTCCAGGTTGGATTTTATTCTCCAGTGCTAAGTTATCTGCTTTTGGTGTTTCAGAGAATATTACTTTAGTATTTCCATCGTTCCTGCCACACAGTTCTGCTGGAGAACGTTTACTTGGCCCTTCTACCAGCACCAGCTGGGTACTTCCCACAGTTCTCTGATTCACTCTTCCAGCCTCCTCTCTGAAGACAGAAATGAGCTCCTCCAACCGCCGTTGTTTTACCTCTGGGGGAACATCATCCTGCAGTCTATGATATGCCCTTGTTTTCTTTCTCATGCTGTAGGCGAACAGATAGGCTGCATTATAGGAAACCTCCCGTAAGAGCGACAAAGTTTGCTGATGATCCTCCTCTGTCTCCTGGCAGAAGCCCGTAATGAAATCACTGCTGAGACTCACACCTGGAATGGATTCCCGAATATTCTGAATCAGATCCAGATAAGCTTCTCTGCTGTACCCTCTTCTCATGCTCTCCAGAACTCTATTACTTCCACTCTGAGCCGGGGATGTGGATTTGTTTTGCAATGTTGTGACGTTCAGCAATTACCTGGAGAACGTCGTCCTGGAAATCTTTGGGGAAGGGGGAGAAGTAAAACGAAAATCTCATTTTCAGGGTCAATCTTAAAAAGAGTTTAACCCGGGGAAAACTTACAAACCCTCAAGGCCCCCCCTTTTTTTTTTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTAAGCAGGAGACTTCTGG