ORFeome > cdk7 ORF1 – XORFeome v1.0

cdk7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk7
Gene ID: 485511
Gene Page ID: 485506
ORF Xenbase ID: 17268873

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130134
Original XGC clone length: 1059

Human orthology & disease relationships

NCBI Entrez ID: 1022
Ensembl gene IDs: ENSG00000134058
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,118700,151623,180849,203655,209500,214150,216400,245590,259500,277440,601675,607136,609048

Library Location

Plate ID: GDExl11090
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838568
dbEST ID: 79656270
Trimmed Sequence: ATGGAAGGTATAGCGGCGAGAGGGGTGGACGTGCGGTCCCGTGCCAAGCAGTATGAGAAGCTGGATTTCCTAGGCGAAGGGCAGTTTGCCACTGTTTATAAAGCCCGAGACAAGAATACTGATAGAATTGTGGCCATTAAAAAGATTAAACTGGGGCATAGAGCAGAAGCTAATGATGGGATAAACAGAACAGCGCTGAGAGAGATAAAGCTACTACAGGAGTTAAGCCATCCTAATATCATTGGGCTACTGGATGCTTTTGGACACAAATCCAACATAAGCCTGGTGTTTGATTTTATGGAGACGGATCTTGAGGTCATAATAAAAGATACCAGCTTGGTATTAACTCCAGCTCATATTAAATCATACATGCTGATGACTCTTCAAGGCTTGGAATACTTACACCATCTCTGGATCCTCCATAGAGATTTAAAGCCGAATAATTTGTTGCTGGATGAAAATGGGGTCCTTAAACTTGCTGATTTTGGTCTTGCAAAGTCATTTGGGAGTCCAAACAGAATATATACTCATCAAGTGGTAACAAGGTGGTACCGATCTCCTGAGTTGCTGTTTGGTGCTAGAATGTTTGGTGTGGGAGTTGACATTTTGGCCGGTGGCTGCATCTTAACTAAACTGCTACTTCCGGTTGCCTTTTTTCCTGGGGAATTTGATCTGAACCAGCCTACCGAAATAATTTTAAACTTTTGGGAACACCCACTGAAAAAACAGGGGCCGGGAGGGGGGCCCGGCCTTTCGGGAACGTTTTTTCCCCTTTTTAGAGTTTTTTCAGGGGATCGCACCCGGGCGCCCCCCGGTTTTTTTTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGGTATAGCGGCGAGAGGGGTGGACGTGCGGTCCCGTGCCAAGCAGTATGAGAAGCTGGATTTCCTAGGCGAAGGGCAGTTTGCCACTGTTTATAAAGCCCGAGACAAGAATACTGATAGAATTGTGGCCATTAAAAAGATTAAACTGGGGCATAGAGCAGAAGCTAATGATGGGATAAACAGAACAGCGCTGAGAGAGATAAAGCTACTACAGGAGTTAAGCCATCCTAATATCATTGGGCTACTGGATGCTTTTGGACACAAATCCAACATAAGCCTGGTGTTTGATTTTATGGAGACGGATCTTGAGGTCATAATAAAAGATACCAGCTTGGTATTAACTCCAGCTCATATTAAATCATACATGCTGATGACTCTTCAAGGCTTGGAATACTTACACCATCTCTGGATCCTCCATAGAGATTTAAAGCCGAATAATTTGTTGCTGGATGAAAATGGGGTCCTTAAACTTGCTGATTTTGGTCTTGCAAAGTCATTTGGGAGTCCAAACAGAATATATACTCATCAAGTGGTAACAAGGTGGTACCGATCTCCTGAGTTGCTGTTTGGTGCTAGAATGTTTGGTGTGGGAGTTGACATTTTGGCCGGTGGCTGCATCTTAACTAAACTGCTACTTCCGGTTGCCTTTTTTCCTGGGGAATTTGATCTGAACCAGCCTACCGAAATAATTTTAAACTTTTGGGAACACCCACTGAAAAAACAGGGGCCGGGAGGGGGGCCCGGCCTTTCGGGAACGTTTTTTCCCCTTTTTAGAGTTTTTTCAGGGGATCGCACCCGGGCGCCCCCCGGTTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGTATAGCGGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838567
dbEST ID: 79656269
Trimmed Sequence: AAAACTCAACTTCTTAGCAATGTCTTTTTGATCCATGCCTTCTGTCCGCTTTCTCTTTATTCCCAGGTTGAGATTTTGCTGCTCCTTTAATGCTTCTATAGAACAATTGGGTCTTGGCAACAAGTTTCCTGGGGTTGGTGCCGGTCTGTTGCTAAAATACCTTTTTCGAAGTGCCTGGGATGCTGTGCATCTTGCACACGGATTAAAGGTAAATAAACCTTGCAGGAGTTCAAGAAGATCATCGCCAGCAGCAATAAAAATGAGGTGCAGTGGTGTCCCTGGAAAACTTTTAAAGGCAACATAGTCTGGAAGGCTGGACATGCCCGGCCACTGCTCTTCAGTTGGTGTTCCCAAAGTTTCAAATATTCTCGTTAGCTGGTCTAGATCAGAATCCCCAGGTAAAAAAGGCACCCGAAGTAGCAGCTCAGCTAAGATGCAGCCAACTGCCCACATGTCAACTCCCACACCATACATTCTAGCACCAAACAGCAACTCAGGAGATCGGTACCACCTTGTTACCACTTGATGATTATATATTCTGTTTGGACTCCCAGATGACTTTGGCAGACCAGAATCAACAAGTTTTAAGGACCCCATTTTCTTCCAGCATCAAATTTATTCGGCTTTGAATTCTCTTTTGAAGGAACCAAAGAAGGGTGGAAGTAATTCCAAGCCCTTTGAAAAATATTCCGCAGTGTAGGAATTTGATATGAACCTGGATTTAATACCCAGGGCTGGGTTATCTTTTTTTTTAGAGACCTCCGGGGAGCCCGTTC
Full Trace Sequence: AAAACTGCTATTGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAACTCAACTTCTTAGCAATGTCTTTTTGATCCATGCCTTCTGTCCGCTTTCTCTTTATTCCCAGGTTGAGATTTTGCTGCTCCTTTAATGCTTCTATAGAACAATTGGGTCTTGGCAACAAGTTTCCTGGGGTTGGTGCCGGTCTGTTGCTAAAATACCTTTTTCGAAGTGCCTGGGATGCTGTGCATCTTGCACACGGATTAAAGGTAAATAAACCTTGCAGGAGTTCAAGAAGATCATCGCCAGCAGCAATAAAAATGAGGTGCAGTGGTGTCCCTGGAAAACTTTTAAAGGCAACATAGTCTGGAAGGCTGGACATGCCCGGCCACTGCTCTTCAGTTGGTGTTCCCAAAGTTTCAAATATTCTCGTTAGCTGGTCTAGATCAGAATCCCCAGGTAAAAAAGGCACCCGAAGTAGCAGCTCAGCTAAGATGCAGCCAACTGCCCACATGTCAACTCCCACACCATACATTCTAGCACCAAACAGCAACTCAGGAGATCGGTACCACCTTGTTACCACTTGATGATTATATATTCTGTTTGGACTCCCAGATGACTTTGGCAGACCAGAATCAACAAGTTTTAAGGACCCCATTTTCTTCCAGCATCAAATTTATTCGGCTTTGAATTCTCTTTTGAAGGAACCAAAGAAGGGTGGAAGTAATTCCAAGCCCTTTGAAAAATATTCCGCAGTGTAGGAATTTGATATGAACCTGGATTTAATACCCAGGGCTGGGTTATCTTTTTTTTTAGAGACCTCCGGGGAGCCCGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAACTCAACTTCTTAGCAATGTC