ORFeome > cdkn2b ORF1 – XORFeome v1.0

cdkn2b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdkn2b
Gene ID: 6252794
Gene Page ID: 478745
ORF Xenbase ID: 17268921

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123180
Original XGC clone length: 378

Human orthology & disease relationships

NCBI Entrez ID: 1030
Ensembl gene IDs: ENSG00000147883
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,151623,155601,242860,259500,606719,608089,609048,609310

Library Location

Plate ID: GDExl11088
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATTTCAATGCCAACACACTGTGCTGTGCTAGTGCCCGGGGTGATGTGAATCTGGCAAGACAGATGCTACAGAGTGGTATCCCAATAAATGCCCCAAACTCTCATGGAAGGACCCCAATCCAGGTCATGATGATGGGCAGTCCTCAAATGGCTGAATTGCTGCTGGATTACGGCGCTGACCCAAGTGTTCCTGACCCCAGTACAGGAACCTGCCCAACTCATGATGCAGCCCGTGAAAGCTTTTTGAACACTCTGCTAATGCTGCTGATGAATGAGGCAAATCTCTACCAACCACTATACAAAAATGTTCTACGACCAATAGAAATGGCTTCTCCAGACCCAAAATCAAAAAAACTGTTGCTATGATAGCTCTTGTTAACTTCCTCATCCTAGAAAGAGATGGAATAAAAGCAATGACTAAAAATTGTTATTCATCGAACAAAATAAGTATCAATTAGATAAAAAATGTATAATTGTTTTCGGCGGGACACCACNAGCNCTTANACTGGAAAAAAAAAAAGAATAAAATNGTNNNNAAAAAAAAAAATAAAAAAAAAAAAAAAAATTACTTGCCTCTTTGAAAACCCCGGGCAAAAAAAAAGCCAGCTCTCCGTGCACCAAAAAAAAAAAAAATGAAAAAAAATTGATAAAAAAAAAGGGCCCCACCCCCACGACCCCCCGGAGAAAATTTGCTCTCCTTTCTTTTTCCGTCAAAACAAAGGGTGGGGGGGGGAAAAAACAAAACGGGGGGGGAGGGGGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATTTCAATGCCAACACACT

Sequences - 3ʹ (reverse) EST

Accession: JZ838084
dbEST ID: 79655786
Trimmed Sequence: GCGATATCCTAGCAACAGTAATTTTGCTTTTAGGTCTGGTGAAGCCAGGTCTATGGGTCGCTGACCATAGTTGTCCCGTGGTTCGTAGAGATTTGCCCCATTCCTCAGCAGCACTAGCAGAGTGTCCAAAAAGCCTTCACGGGCTGCATCATGAGTTGGGCAGGTTCCTGTACTGGGGTCAGGAACACTTGGGTCAGCGCCGTAATCCAGCAACAATTCAGCCATTTGAGGACTGCCCATCATCATGACCTGGATTGGGGTCCTTCCATGAGAGTTTGGGGCATTTACTGGGATACCACTCTGTAGCATCTGTCTTGCCAGATTCACATCACCCCGGGCACTAGCACAGCACAGTGTGTTGGCATTGAAATCCATGG
Full Trace Sequence: GGGGCATATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCGATATCCTAGCAACAGTAATTTTGCTTTTAGGTCTGGTGAAGCCAGGTCTATGGGTCGCTGACCATAGTTGTCCCGTGGTTCGTAGAGATTTGCCCCATTCCTCAGCAGCACTAGCAGAGTGTCCAAAAAGCCTTCACGGGCTGCATCATGAGTTGGGCAGGTTCCTGTACTGGGGTCAGGAACACTTGGGTCAGCGCCGTAATCCAGCAACAATTCAGCCATTTGAGGACTGCCCATCATCATGACCTGGATTGGGGTCCTTCCATGAGAGTTTGGGGCATTTACTGGGATACCACTCTGTAGCATCTGTCTTGCCAGATTCACATCACCCCGGGCACTAGCACAGCACAGTGTGTTGGCATTGAAATCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACGCTTNTAAAAAAAAAAAAAATAAAAAAAAATTACGGGGCACTGGAAATCCGCGGGCGCGAAAAAGCACAAGGGCCCCCCAAAACAAGGGTTTTGGGGGTTGCCATTTTTGTGAAGGGGAAAAGGCCCAAACACACGGGAAAAAAACCGGGGGGGGGTCTTGGGCTTTTGAGGAAAAGGGGGGGCGCGCCCCACCCGTGGCCCAAAACTTAGGGAAAGCAACGCGGGTGGGGCCCCGGCCGGGGGGGGTTTTTTTAGGGGTGTTGTGGTGTTGTTTTTTTTTTTTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCGATATCCTAGCAACAGTAA