ORFeome > cdx2 ORF2 – XORFeome v1.0

cdx2 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdx2
Gene ID: 864967
Gene Page ID: 483305
ORF Xenbase ID: 17268975

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108596
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: F05

Sequences - 5ʹ (forward) EST

Accession: JZ837932
dbEST ID: 79655634
Trimmed Sequence: ATGTACGTGAGTTACTTATTGGAAAAGGACGCTGCTGCCATGTACCCTGGATCTATGCGCGCCCACCCGGGGCTCCAGAACTACCCCTCTGCCCCCCAGTACCCTGACTATGCCGGATACCATGCAATGGGCACAGACCATGGGGCACCTTCCTCTGGTTCCTCGGCTGGCTGGATCACCCCCTATGGACCCCCAAGGGATGAATGGGGGGTCCATCCGACGTACTCCCCTGGGCACTCTCACATCAACCCCTCTCCTGTAGGAGAACATGGCCTTTAGCCCTGAATATTCCCCGGCGCAGGTGCAGGGACAGCCTTGTGTTGGGGTATTACCAGCTGGGCCCCCACCACCACCCCCTCAGCTATCGCCTGGATCAAAGGATGGGCACCGGCGGCATCACTACAAATGGCTCAGGAAACCCGTCCCCCAGGCCAGCATTGGAACCAAGACAAGGACAAAGGACAAGTATCGCGTTGTATACACAGACCAGCAGCGGTTAGAGCTGGAGAAGGAATTCCATTACAGCAGATATATCACTATCAGGAGGAAAGCAAAGCTGGCAGTTAATCTGGGGCTCTCAAAGAGACAGGGTAAGATTTGGTTCCAAAAACAAAGAACCCAAAAAAAAAAAATTCAACAAAAAAAAAATCCCAGCAAACTGGCCCAAATGGAACAAAACACTCCCAGCCCCAAAACCCCTCCTTACCCCACCACATGAAAAAAACAGGCTACAAATAACGGGGGGGGGTCTTGGCCCCATAAACCGTCACCCAACTTTGCCAACCTTTTTTTTGTTACAAAAGTTTTTGGAAATTATAAAAA
Full Trace Sequence: GGCCCTCTAGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTACGTGAGTTACTTATTGGAAAAGGACGCTGCTGCCATGTACCCTGGATCTATGCGCGCCCACCCGGGGCTCCAGAACTACCCCTCTGCCCCCCAGTACCCTGACTATGCCGGATACCATGCAATGGGCACAGACCATGGGGCACCTTCCTCTGGTTCCTCGGCTGGCTGGATCACCCCCTATGGACCCCCAAGGGATGAATGGGGGGTCCATCCGACGTACTCCCCTGGGCACTCTCACATCAACCCCTCTCCTGTAGGAGAACATGGCCTTTAGCCCTGAATATTCCCCGGCGCAGGTGCAGGGACAGCCTTGTGTTGGGGTATTACCAGCTGGGCCCCCACCACCACCCCCTCAGCTATCGCCTGGATCAAAGGATGGGCACCGGCGGCATCACTACAAATGGCTCAGGAAACCCGTCCCCCAGGCCAGCATTGGAACCAAGACAAGGACAAAGGACAAGTATCGCGTTGTATACACAGACCAGCAGCGGTTAGAGCTGGAGAAGGAATTCCATTACAGCAGATATATCACTATCAGGAGGAAAGCAAAGCTGGCAGTTAATCTGGGGCTCTCAAAGAGACAGGGTAAGATTTGGTTCCAAAAACAAAGAACCCAAAAAAAAAAAATTCAACAAAAAAAAAATCCCAGCAAACTGGCCCAAATGGAACAAAACACTCCCAGCCCCAAAACCCCTCCTTACCCCACCACATGAAAAAAACAGGCTACAAATAACGGGGGGGGGTCTTGGCCCCATAAACCGTCACCCAACTTTGCCAACCTTTTTTTTGTTACAAAAGTTTTTGGAAATTATAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGTGAGTTACTTATTGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837931
dbEST ID: 79655633
Trimmed Sequence: CTGAGTGACGGTATTTGGCAAGACCCCCACGTTACTTGTAGCATGTTGTATCATGTGGTGGGTAATGGAGGGTTCTGGGCTGAGAGTGTCTGGTCCATTTTGGCCAGTCTGCTGGATTCTTTTCTTGTTGATTTTTCTTTCTTTGGCTCTTCTGTTTTGGAACCAAATCTTTACCTGTCTCTCTGAGAGCCCCAGATTAACTGCCAGCTCTGCTTTCCTCCTGATAGTGATATATCTGCTGTAATGGAATTCCTTCTCCAGCTCTAACCGCTGCTGGTCTGTGTATACAACGCGATACTTGTCCTTTGTCCTTGTCTTGGTTCCAATGCTGGCCTGGGGGACGGGTTTCCTGAGCCATTCGTAGTGATGCCGCCGGTGCCCATCCTCTGATCCAGGCGATAGCTGATGGGGTGGGTGGTGGGGGCCCAGCTGGTAAGACCACAACACAAAGCCTGCCCTCCACCTCCCCCGGGCAAGATACATATCCTACGGCCAGGTTCTCTACACGACAGGGATGGATGTGAGTAGTCCAACCCGAGTGCATGAAAATGAGACCCCAATCCACCCTTCCCCCTGAGAGGCAGATGAGAGGGGACGCGCCACCCACCACAACCAAAAAAAAACACCCCCGCCCCCCAGGCCCGGGTTCACGGGGCAGAGCAAAGAGGGGAGAGGGTGGGGGGGGGGGGGGGGGGGGGCCGCCCCCCCCCCGGGGGGTCGGGCGGGGGGGGGAGGGGGGAAAGAGGGGGGGGTATAGCCCCGCTGGCGTTCCTCCG
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGAGTGACGGTATTTGGCAAGACCCCCACGTTACTTGTAGCATGTTGTATCATGTGGTGGGTAATGGAGGGTTCTGGGCTGAGAGTGTCTGGTCCATTTTGGCCAGTCTGCTGGATTCTTTTCTTGTTGATTTTTCTTTCTTTGGCTCTTCTGTTTTGGAACCAAATCTTTACCTGTCTCTCTGAGAGCCCCAGATTAACTGCCAGCTCTGCTTTCCTCCTGATAGTGATATATCTGCTGTAATGGAATTCCTTCTCCAGCTCTAACCGCTGCTGGTCTGTGTATACAACGCGATACTTGTCCTTTGTCCTTGTCTTGGTTCCAATGCTGGCCTGGGGGACGGGTTTCCTGAGCCATTCGTAGTGATGCCGCCGGTGCCCATCCTCTGATCCAGGCGATAGCTGATGGGGTGGGTGGTGGGGGCCCAGCTGGTAAGACCACAACACAAAGCCTGCCCTCCACCTCCCCCGGGCAAGATACATATCCTACGGCCAGGTTCTCTACACGACAGGGATGGATGTGAGTAGTCCAACCCGAGTGCATGAAAATGAGACCCCAATCCACCCTTCCCCCTGAGAGGCAGATGAGAGGGGACGCGCCACCCACCACAACCAAAAAAAAACACCCCCGCCCCCCAGGCCCGGGTTCACGGGGCAGAGCAAAGAGGGGAGAGGGTGGGGGGGGGGGGGGGGGGGGGCCGCCCCCCCCCCGGGGGGTCGGGCGGGGGGGGGAGGGGGGAAAGAGGGGGGGGTATAGCCCCGCTGGCGTTCCTCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGAGTGACGGTATTTGGCAAGA