ORFeome > cecr5 ORF1 – XORFeome v1.0

cecr5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cecr5
Gene ID: 866577
Gene Page ID: 854825
ORF Xenbase ID: 17269029

ORF full-length analysis tests

Full-Length confidence: medium
Original XGC clone accession: BC129552
Original XGC clone length: 1239

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ837851
dbEST ID: 79655553
Trimmed Sequence: ATGAGGTTCTGTTGCACTTTGGCCAAAGTCGCTGGGAGATGTCAATCAAGACAATTGGCAGGGGGCGCGGGGCTCAGGAGATTCACTGCTTCGTCCGTACAGCCAACTCCAAGATTTGGCCTCCTGTTTGATATCGATGGGGTCATTGTGAGGGGAAAAAACCCCATCCCAGGGGCGGCCGAGGCCTTCAAGAAGCTGGTGGGCAGAGACGGGCGAATGACGGTGCCTGTGGTTTTTGTGACTAATGCGGGGAATTGCGTGCGCCAAACCAGGGCGATGGAGCTGACCAAAGTGTTGGGTGTTGAGGTGTTACCAGAGCAAGTCATTCTCTCTCATAATCCCCTGCGCATGTTCCACCAATTCCACGACAAATGCATCCTGATGTCTGGCCAGGGGCCCGTGGATGAGATAACCCGGCACCACGGCTTCCAAAATGTTGTTACCATTAATGACCTGCAAATGGCGTACGCTTTGCTTTATATGGTGGATGACAATCACAGACCTAAAAATCCACCGCCTGTGAACGGTGAATTTCCAACAAAAAAAACTATGATCCGATTTCCTAAGCGTGTGAGCTTGGGGGGGGGGCATACCACTCATCCCTGAATAACAGAATAATGAACAGGAGAGGCGGGGGGCTGGGAGGGCGGGGGCCCTCTCGCGCGCCCGGTCCCCTCTCTTTATCTGTTTTAAAGGAGGGAAAAAGGGGAGGGGGGGGGGGGGGGGGAAGACACACCAAAAAAAACAACGGGGGGGGTGGGGGGGTGCGGCCCTTGTTGTAGGGCGTGTGTGGGGGGGGAGATATATTTTTTTGTTGGGATAT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGTTCTGTTGCACTTTGGCCAAAGTCGCTGGGAGATGTCAATCAAGACAATTGGCAGGGGGCGCGGGGCTCAGGAGATTCACTGCTTCGTCCGTACAGCCAACTCCAAGATTTGGCCTCCTGTTTGATATCGATGGGGTCATTGTGAGGGGAAAAAACCCCATCCCAGGGGCGGCCGAGGCCTTCAAGAAGCTGGTGGGCAGAGACGGGCGAATGACGGTGCCTGTGGTTTTTGTGACTAATGCGGGGAATTGCGTGCGCCAAACCAGGGCGATGGAGCTGACCAAAGTGTTGGGTGTTGAGGTGTTACCAGAGCAAGTCATTCTCTCTCATAATCCCCTGCGCATGTTCCACCAATTCCACGACAAATGCATCCTGATGTCTGGCCAGGGGCCCGTGGATGAGATAACCCGGCACCACGGCTTCCAAAATGTTGTTACCATTAATGACCTGCAAATGGCGTACGCTTTGCTTTATATGGTGGATGACAATCACAGACCTAAAAATCCACCGCCTGTGAACGGTGAATTTCCAACAAAAAAAACTATGATCCGATTTCCTAAGCGTGTGAGCTTGGGGGGGGGGCATACCACTCATCCCTGAATAACAGAATAATGAACAGGAGAGGCGGGGGGCTGGGAGGGCGGGGGCCCTCTCGCGCGCCCGGTCCCCTCTCTTTATCTGTTTTAAAGGAGGGAAAAAGGGGAGGGGGGGGGGGGGGGGGAAGACACACCAAAAAAAACAACGGGGGGGGTGGGGGGGTGCGGCCCTTGTTGTAGGGCGTGTGTGGGGGGGGAGATATATTTTTTTGTTGGGATAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTCTGTTGCACTTTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837850
dbEST ID: 79655552
Trimmed Sequence: TTCACTCGCACTCTCTAATCCTTCACTCTCTGAGACCCAACCCTCTTCCCTCAGCACCAAATTCACAGCATGTTCCACGTCTTTCACAATGTGCGATGCCTCCACCAAGGTGGGGTCTAGTCGGAAGTCTCGGTGCCCATGGAAGACGGTCTGGGTCACGCTCTCCCGTGTGTCCGTTGGCACCTCCCCCTGATTGCCGTACACCCCAGTGCACACCAGGATAGACCGGCAGCTGTGGGGCAGCCCATCCTCGGACTTCCCCCGGTTGCTCGTTAGGAAGTGATTGTAGAGATTGGCCCCGTAGATGTCTGCCATTGGATTGTCCCCAATAGCGTACAGTGTGCGGATAGGTGCATCCCATCCCCTCTTCCTCGCCTGCTCCAGAATAAGGTGCTCTGCAAAACTATACGTCACCATACTGGGTTTCCCAATGAGCGCCTCGTACCTCAGCTCCCGCCCAGTAAGTTTGTGATAGAGAGTCTCCAGGCAGACAAGGAACGTGCCGTGCCCAAACCTGGGGTTCTTAGCTTCGGCCATCCATTGCAGGTCCATGTTACAGGCAAGGACAGGGATATGAGGGTACGGGACCTGGGGAAGCCATGCCCTTGGGCCCCCGTTGCTCAATAGTATATCGAGGATTAGCTGTAGGCTGGTCTCCCACCCCACAAGCTCACCCAATAAGATCACAGCTTCTATTTCTGGAAGGTTCTGGATCCAAGGCGGTGGATTTTTAGGTCTGCGAGTGTGATCCACGCTAAGAAGCAAAGGGTACGCGGTTCCGAGGTCAGTAGAGGGGAAGAACAGTTTTTGAACCCCTGGGTCCGGGGGTACGTCATCCAGGGGCCCCCTGGCGAGAGCTCCGGAAGCATTTTGGGTGGAATTGGGTGGAGAAAGGGCCAGGGGGGTAGGGAAAGAAAATAATTTTGACCTGGTGACCCGGCGGGGACCACGAAATTTGATCGAGGCCAGTCCCCCGCGGTTTACCTGCAGACGGAGGTCCCGAGAGTAGTTAAAAAAAAGCAAAAAGGACCCGGACTTGTCCGCCGGTGCCCTGCCCCCCCCCACCCGTCTGTGAGGCGCCCCGAGCCCGGCCCCGGGGGGGAGGGGAGGGGTTTTGTTCGCCGGGCGTTGGGGGGGGGTGCCTGGCGGGAGGGTGGGGAGGGGGGGGAGAAGCGCCGAGAAGGAGGGCGGGGTGAGGGAGAGGTGGGAGAGTGAGGTGGAAGAGGGGA
Full Trace Sequence: GGGGCGGGGAATCAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCACTCGCACTCTCTAATCCTTCACTCTCTGAGACCCAACCCTCTTCCCTCAGCACCAAATTCACAGCATGTTCCACGTCTTTCACAATGTGCGATGCCTCCACCAAGGTGGGGTCTAGTCGGAAGTCTCGGTGCCCATGGAAGACGGTCTGGGTCACGCTCTCCCGTGTGTCCGTTGGCACCTCCCCCTGATTGCCGTACACCCCAGTGCACACCAGGATAGACCGGCAGCTGTGGGGCAGCCCATCCTCGGACTTCCCCCGGTTGCTCGTTAGGAAGTGATTGTAGAGATTGGCCCCGTAGATGTCTGCCATTGGATTGTCCCCAATAGCGTACAGTGTGCGGATAGGTGCATCCCATCCCCTCTTCCTCGCCTGCTCCAGAATAAGGTGCTCTGCAAAACTATACGTCACCATACTGGGTTTCCCAATGAGCGCCTCGTACCTCAGCTCCCGCCCAGTAAGTTTGTGATAGAGAGTCTCCAGGCAGACAAGGAACGTGCCGTGCCCAAACCTGGGGTTCTTAGCTTCGGCCATCCATTGCAGGTCCATGTTACAGGCAAGGACAGGGATATGAGGGTACGGGACCTGGGGAAGCCATGCCCTTGGGCCCCCGTTGCTCAATAGTATATCGAGGATTAGCTGTAGGCTGGTCTCCCACCCCACAAGCTCACCCAATAAGATCACAGCTTCTATTTCTGGAAGGTTCTGGATCCAAGGCGGTGGATTTTTAGGTCTGCGAGTGTGATCCACGCTAAGAAGCAAAGGGTACGCGGTTCCGAGGTCAGTAGAGGGGAAGAACAGTTTTTGAACCCCTGGGTCCGGGGGTACGTCATCCAGGGGCCCCCTGGCGAGAGCTCCGGAAGCATTTTGGGTGGAATTGGGTGGAGAAAGGGCCAGGGGGGTAGGGAAAGAAAATAATTTTGACCTGGTGACCCGGCGGGGACCACGAAATTTGATCGAGGCCAGTCCCCCGCGGTTTACCTGCAGACGGAGGTCCCGAGAGTAGTTAAAAAAAAGCAAAAAGGACCCGGACTTGTCCGCCGGTGCCCTGCCCCCCCCCACCCGTCTGTGAGGCGCCCCGAGCCCGGCCCCGGGGGGGAGGGGAGGGGTTTTGTTCGCCGGGCGTTGGGGGGGGGTGCCTGGCGGGAGGGTGGGGAGGGGGGGGAGAAGCGCCGAGAAGGAGGGCGGGGTGAGGGAGAGGTGGGAGAGTGAGGTGGAAGAGGGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCACTCGCACTCTCTAATCCT