ORFeome > cel ORF1 – XORFeome v1.0

cel ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cel
Gene ID: 1217490
Gene Page ID: 1217487
ORF Xenbase ID: 17269035

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054227
Original XGC clone length: 1662

Human orthology & disease relationships

NCBI Entrez ID: 1056
Ensembl gene IDs: ENSG00000170835
Directly associated (OMIM) disease MIM numbers: 609812
Indirectly associated (Lage, et al.) disease MIM numbers: 238600,603813,609812

Library Location

Plate ID: GDExl11003
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ839481
dbEST ID: 79657183
Trimmed Sequence: ATGGCTTTTTGGGCTTCTCTTGCCTTGGTTTGTGCCAGTCTGGTGGCAGTGTCCCAGGCTGCGTCACTGGGAGTGGTTTACACGGAGGGTGGATTTGTAGAAGGTACCAGCAAGAAAATTGGGATCCTCTTCCCAGATTACATTGATGTTTTTAAGGGGATCCCCTTCGCAGCTCCACCAAAAGCCTTTGAGAAGGCAGAACAGCACCCAGGCTGGTCAGGTACATTAAAGACCAAAGATTTTAAGCCACGGTGCTTGCAATCCACCTTAACCCAAAAAGATGTCCGTGGTGAATTAGACTGCCTCTACCTGAACATCTGGGTTCCTCAGTCCCGCTCGTCAGTGTCCACCAACCTACCAGTCATGGTTTGGATCTACGGCGGGGCCTTCTTGCTCGGTTCATCTCAGGGGGCCAATGTGTTAGATAACTATCTGTACGATGGAGAGGAGCTTGCTCTGCGTGGCAATGTCATTGTGGTCACCTTGAACTATAGACTGGGACCATTGGGCCTTCTGAGTACTGGAGACTCCAACCTTCCTGGCAACTATGGACTGTGGGATCAACACATGGCCATTGCCTGGGTGAAAAGGAACATTGCCGCGTTTGGTGGGAACCCCGATAACATCACCATATTTGGGGAGTCTGCTGGAGGCGCCAGTGTCTCTCTTCAAACCCTGTCTCCCTATTACAAAGGACTGATCAACGAGCATCAGCCNAGAGTGGGGTGGGCATGTCCCCTTGGGCACTTCAAGCAACCACTTTTCGGAACTACAAGGTGGCTTTAAAAAAATTTGGATGTCCTGTGGACAAAAAACGACGGCCATGGGGGAAAT
Full Trace Sequence: GACACCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTTTGGGCTTCTCTTGCCTTGGTTTGTGCCAGTCTGGTGGCAGTGTCCCAGGCTGCGTCACTGGGAGTGGTTTACACGGAGGGTGGATTTGTAGAAGGTACCAGCAAGAAAATTGGGATCCTCTTCCCAGATTACATTGATGTTTTTAAGGGGATCCCCTTCGCAGCTCCACCAAAAGCCTTTGAGAAGGCAGAACAGCACCCAGGCTGGTCAGGTACATTAAAGACCAAAGATTTTAAGCCACGGTGCTTGCAATCCACCTTAACCCAAAAAGATGTCCGTGGTGAATTAGACTGCCTCTACCTGAACATCTGGGTTCCTCAGTCCCGCTCGTCAGTGTCCACCAACCTACCAGTCATGGTTTGGATCTACGGCGGGGCCTTCTTGCTCGGTTCATCTCAGGGGGCCAATGTGTTAGATAACTATCTGTACGATGGAGAGGAGCTTGCTCTGCGTGGCAATGTCATTGTGGTCACCTTGAACTATAGACTGGGACCATTGGGCCTTCTGAGTACTGGAGACTCCAACCTTCCTGGCAACTATGGACTGTGGGATCAACACATGGCCATTGCCTGGGTGAAAAGGAACATTGCCGCGTTTGGTGGGAACCCCGATAACATCACCATATTTGGGGAGTCTGCTGGAGGCGCCAGTGTCTCTCTTCAAACCCTGTCTCCCTATTACAAAGGACTGATCAACGAGCATCAGCCNAGAGTGGGGTGGGCATGTCCCCTTGGGCACTTCAAGCAACCACTTTTCGGAACTACAAGGTGGCTTTAAAAAAATTTGGATGTCCTGTGGACAAAAAACGACGGCCATGGGGGAAAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTTTGGGCTTCTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839480
dbEST ID: 79657182
Trimmed Sequence: CGCGTTGGCCATATTACGGTAGGTTTGGGCCCAGAATTTGACGTAAGGGGATCGGAGGCTCTGCTTTACGGATTGGTAAGACATCTTGTCGTTGATTTCCAGGTACTGGCCAAGGCGAGTGGTATAAGGCAGCCAAGTGGTGGGGACTTTGGAGGGTCCTTGGCTGGGGTCACCAGTTGCAGCAAAGTTGGTCCAATAGGCAATCATGGTAGCAGAGACATCTCTGTCCTTGGGTCTGTAAGCCAATGGTGTCTGGAAGGGTTTCCCAAACACATACTGCAAGTCGTCGGCATGATCGGCTCCCACCCAGTTGGGGTAAATGGGCATACGGGTCGGCAAAGAGAAAACGTAGTTGTAAGTCCGGCCACTTCGGGCATTCATGGAGTGAAGTGCCAGTGCCTCTTGGGTTGGGACCAAGAAGAGATAATCCGTCTCCAAGTCTATGACTGTTCTTTTCATATTCTCCTGCTCAGGGTTGGGACCCCAGTTACCCGTGTAAAGGGTGTAGGCAGTTTCCGAGGCACTGGAGATTTTAGTAGGGGGCAAATCCTGGCACAGATTATAGATGTGGGCCTCAGAAATCTTCCTAAAATGCTTATTGAATAAGTGGCAAATCGAGTGGGCTGCAACAAATTGTGCGTCCATATTGGTCACCCCCCGGCCGATAAGGCAAAATCAACCCCCATTTGCAAAGAGGAGTGCGGCGGGTCCTTCCCCGGAAGGAAAATCACCCCATCAAAAAACCCGCGTAAAATTCCCAAAAAAAAAAAAGAGTTG
Full Trace Sequence: GAAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCGTTGGCCATATTACGGTAGGTTTGGGCCCAGAATTTGACGTAAGGGGATCGGAGGCTCTGCTTTACGGATTGGTAAGACATCTTGTCGTTGATTTCCAGGTACTGGCCAAGGCGAGTGGTATAAGGCAGCCAAGTGGTGGGGACTTTGGAGGGTCCTTGGCTGGGGTCACCAGTTGCAGCAAAGTTGGTCCAATAGGCAATCATGGTAGCAGAGACATCTCTGTCCTTGGGTCTGTAAGCCAATGGTGTCTGGAAGGGTTTCCCAAACACATACTGCAAGTCGTCGGCATGATCGGCTCCCACCCAGTTGGGGTAAATGGGCATACGGGTCGGCAAAGAGAAAACGTAGTTGTAAGTCCGGCCACTTCGGGCATTCATGGAGTGAAGTGCCAGTGCCTCTTGGGTTGGGACCAAGAAGAGATAATCCGTCTCCAAGTCTATGACTGTTCTTTTCATATTCTCCTGCTCAGGGTTGGGACCCCAGTTACCCGTGTAAAGGGTGTAGGCAGTTTCCGAGGCACTGGAGATTTTAGTAGGGGGCAAATCCTGGCACAGATTATAGATGTGGGCCTCAGAAATCTTCCTAAAATGCTTATTGAATAAGTGGCAAATCGAGTGGGCTGCAACAAATTGTGCGTCCATATTGGTCACCCCCCGGCCGATAAGGCAAAATCAACCCCCATTTGCAAAGAGGAGTGCGGCGGGTCCTTCCCCGGAAGGAAAATCACCCCATCAAAAAACCCGCGTAAAATTCCCAAAAAAAAAAAAGAGTTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCGTTGGCCATATTACGGTAG