ORFeome > cel-prov ORF1 – XORFeome v1.0

cel-prov ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol:
Gene ID: 6256515
Gene Page ID:
ORF Xenbase ID: 17269041

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054271
Original XGC clone length: 1662

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ839405
dbEST ID: 79657107
Trimmed Sequence: ATGGCTCTTTGGGCTTCTCTTGCCCTGGCATTTGCCAGTCTGGTGGCAGTGTCCCAGGCTGCTTCACTGGGAGTGGTTTACACCGAGGGTGGATTTGTGGAAGGTACCAGCAAGAAAATTGGGATCCTGTTCCCGAATTACATTGATGTTTTTAAGGGCATCCCGTTTGCTGCTCCACCAAAAGCCTTTGAGAAGGCACAACTGCACCCAGGCTGGTCAGGTACATTAAAAGCCACAAACTTTAAGGAACGGTGCTTACAATCCACCTTAACCCAAACAAATGTCCGTGGTGATTTAGACTGCCTCTACCTGAACATCTGGGTTCCTCAGACCCGCTCTTCAGTGTCCACCAACCTACCAGTCATGGTTTGGATCTACGGTGGGGCCTTCTTGCTCGGTTCATCTCAGGGGGCCAACGTGTTGGATAACTATCTGTATGATGGAGAGGAGCTCGCTCTCCGTGGCAATGTCATTGTGGTGACCTTGAACTACAGACTGGGACCATTGGGCTTTCTGAGTACTGGAGACTCTAACCTTCCTGGCAACTATGGACTGTGGGATCAACACATGGCCATCGCCTGGGTGAAAAGGAACATTGCTGCATTTGGTGGGAACCCTGATAACATCACCATATTTGGAGAGTCTGCTGGAGGCGCCAGTGTCTCCCCTCAGACCCTGTCTCCATACAACAAAAGACTGATCAAGCGAGCCATCAGCCCAAAGTTGGGGGTGGGCATGGT
Full Trace Sequence: GGAGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTGGGCTTCTCTTGCCCTGGCATTTGCCAGTCTGGTGGCAGTGTCCCAGGCTGCTTCACTGGGAGTGGTTTACACCGAGGGTGGATTTGTGGAAGGTACCAGCAAGAAAATTGGGATCCTGTTCCCGAATTACATTGATGTTTTTAAGGGCATCCCGTTTGCTGCTCCACCAAAAGCCTTTGAGAAGGCACAACTGCACCCAGGCTGGTCAGGTACATTAAAAGCCACAAACTTTAAGGAACGGTGCTTACAATCCACCTTAACCCAAACAAATGTCCGTGGTGATTTAGACTGCCTCTACCTGAACATCTGGGTTCCTCAGACCCGCTCTTCAGTGTCCACCAACCTACCAGTCATGGTTTGGATCTACGGTGGGGCCTTCTTGCTCGGTTCATCTCAGGGGGCCAACGTGTTGGATAACTATCTGTATGATGGAGAGGAGCTCGCTCTCCGTGGCAATGTCATTGTGGTGACCTTGAACTACAGACTGGGACCATTGGGCTTTCTGAGTACTGGAGACTCTAACCTTCCTGGCAACTATGGACTGTGGGATCAACACATGGCCATCGCCTGGGTGAAAAGGAACATTGCTGCATTTGGTGGGAACCCTGATAACATCACCATATTTGGAGAGTCTGCTGGAGGCGCCAGTGTCTCCCCTCAGACCCTGTCTCCATACAACAAAAGACTGATCAAGCGAGCCATCAGCCCAAAGTTGGGGGTGGGCATGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCTTTGGGCTTCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839404
dbEST ID: 79657106
Trimmed Sequence: CACGTTGGCCATATTGCGGTAAGTGTGGGCCCAGAATTTCACATAAGGGGAACGTAGACTCTGCTTTACAGATTGGTAAGACATGTTGTCGTTGATTTCCAGGTACTGGCCAAGGTGAGTGGTGTAAGGCAGCCAATCGGTGGGCACTTTGGAGGGTCCTTGGTTGGGGTCACCAGTTGCAGCAAAGTTGGTCCAATAGGCAATCATGGCGGCAGAGACATCTCTATCCTTGGGTCTGTAAGCCAATGGAGTCTGGAAGGGTTTCCCGAACACGTACTGCAAATCATCTGCATGATCGGCTCCGACCCAGCTGGGGTAAATGGGCATGCGAGTCGGCAAAGAGAACACGTAGTTGTAAGTCCGTCCACTCCGAGCATTCATGGAGTGAAGAGCCAGTGCCTCTTGGGTAGGGACCAGGAAAAGATAGTCCGTCTCTAAGTCTATGACAGTTCTTTTCATATTCTCCTGCTCAGGGTTGGGTCCCCAGTTGGCCGTGTAAAGGTTGTAGGCAGTTTCCAAGGCACTGGAGATTTTAGTCAGGGTCAAACCCTGCACCAGATTATAGACTTCGGCCTCAGAAATCTTCTGAAAAGGCTGATTGATAACTGGCAGATCTATGCCTGCAAACAAATGTGCATCCCATGTTTGTTACACCTGGCCATGTAATCCACCATCCGCCGCATTAGCAAAGGAGATTCATTG
Full Trace Sequence: GGGAAAACAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACGTTGGCCATATTGCGGTAAGTGTGGGCCCAGAATTTCACATAAGGGGAACGTAGACTCTGCTTTACAGATTGGTAAGACATGTTGTCGTTGATTTCCAGGTACTGGCCAAGGTGAGTGGTGTAAGGCAGCCAATCGGTGGGCACTTTGGAGGGTCCTTGGTTGGGGTCACCAGTTGCAGCAAAGTTGGTCCAATAGGCAATCATGGCGGCAGAGACATCTCTATCCTTGGGTCTGTAAGCCAATGGAGTCTGGAAGGGTTTCCCGAACACGTACTGCAAATCATCTGCATGATCGGCTCCGACCCAGCTGGGGTAAATGGGCATGCGAGTCGGCAAAGAGAACACGTAGTTGTAAGTCCGTCCACTCCGAGCATTCATGGAGTGAAGAGCCAGTGCCTCTTGGGTAGGGACCAGGAAAAGATAGTCCGTCTCTAAGTCTATGACAGTTCTTTTCATATTCTCCTGCTCAGGGTTGGGTCCCCAGTTGGCCGTGTAAAGGTTGTAGGCAGTTTCCAAGGCACTGGAGATTTTAGTCAGGGTCAAACCCTGCACCAGATTATAGACTTCGGCCTCAGAAATCTTCTGAAAAGGCTGATTGATAACTGGCAGATCTATGCCTGCAAACAAATGTGCATCCCATGTTTGTTACACCTGGCCATGTAATCCACCATCCGCCGCATTAGCAAAGGAGATTCATTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACGTTGGCCATATTGCGGTA