ORFeome > cela1 ORF1 – XORFeome v1.0

cela1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cela1
Gene ID: 5739330
Gene Page ID: 5739189
ORF Xenbase ID: 17269047

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078585
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ839649
dbEST ID: 79657351
Trimmed Sequence: ATGTTGAGGCTGCTGGTACTTGCTGTATTGGTCCTTGGTGGACATTGTTTTGGAAACCTCCGCTTCCTGGAGGATAACACTCGTGTGGTAGGAGGAACTGATGCTTCCCCAAATTCTTGGCCATGGCAGGTTTCACTCCAGATCCAATCAGGCAGTGGCTTTTCCCATACTTGTGGAGGTTCCTTGATCCGCCCCGACAGAGTCCTGACTGCTGCTCACTGTGTGGACAGAGCCGGACCATTCCGTGTCATACTGGGTGAGCACAATCTGAGTGTGAACGAGGGCCCCGAGCAGATCATTGCTGTTTCTCAAATTGTGAAGCACGTCAACTGGAACCCAAACAATGTTGCTGCTGGGTTTGACATTGCTGTGCTCTATCTGGCCTCCAGCGCCTCCTTGAACAGTAACGTGCAACTGGCTACTCTCCCCAATGCTGGAGTAATTCTGGCTCACAATTCCCCTTGCATTATTTCTGGATGGGGCAGGACTGTCACCAATGGACCACTTCCCGCCATCTTGCAGCAAGCCCCTCTGCCTTCAGTAGCCCACTCCACTTGCTCTAACTTTGCCTATTGGGGAAGCACAGTTAAGACCTCCATGGTGTGCGCTGGTGGTGATGGAGTTACTGCTGGATGCAATGGAAATTCTGGGGGTCCCCTCAACTGTCCTAACAACGGTGTATTTAAAGTTCACGGCGTTACCCAATTTTGTGTCTTCCCTTGGGATGTAACGGCTAACCCTAAAGCCCCCAAGGGTTTCACAAAAAATTCTCTTCTTTTACATCAAACTGGGAATCCAAA
Full Trace Sequence: TCGTGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGAGGCTGCTGGTACTTGCTGTATTGGTCCTTGGTGGACATTGTTTTGGAAACCTCCGCTTCCTGGAGGATAACACTCGTGTGGTAGGAGGAACTGATGCTTCCCCAAATTCTTGGCCATGGCAGGTTTCACTCCAGATCCAATCAGGCAGTGGCTTTTCCCATACTTGTGGAGGTTCCTTGATCCGCCCCGACAGAGTCCTGACTGCTGCTCACTGTGTGGACAGAGCCGGACCATTCCGTGTCATACTGGGTGAGCACAATCTGAGTGTGAACGAGGGCCCCGAGCAGATCATTGCTGTTTCTCAAATTGTGAAGCACGTCAACTGGAACCCAAACAATGTTGCTGCTGGGTTTGACATTGCTGTGCTCTATCTGGCCTCCAGCGCCTCCTTGAACAGTAACGTGCAACTGGCTACTCTCCCCAATGCTGGAGTAATTCTGGCTCACAATTCCCCTTGCATTATTTCTGGATGGGGCAGGACTGTCACCAATGGACCACTTCCCGCCATCTTGCAGCAAGCCCCTCTGCCTTCAGTAGCCCACTCCACTTGCTCTAACTTTGCCTATTGGGGAAGCACAGTTAAGACCTCCATGGTGTGCGCTGGTGGTGATGGAGTTACTGCTGGATGCAATGGAAATTCTGGGGGTCCCCTCAACTGTCCTAACAACGGTGTATTTAAAGTTCACGGCGTTACCCAATTTTGTGTCTTCCCTTGGGATGTAACGGCTAACCCTAAAGCCCCCAAGGGTTTCACAAAAAATTCTCTTCTTTTACATCAAACTGGGAATCCAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGAGGCTGCTGGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ839648
dbEST ID: 79657350
Trimmed Sequence: GATGTTATTGTTGATCCAGTCGATGTAAGCAGAGACTCTGGTGAACACTGTGGGCTTCAGGTAAGCATTACATCCCAAGGAGGACACAAAACTGGTAACGCCGTGAACTTCATATACACCGTTGTTAGGACAGTTGAGGGGACCACCAGAATCTCCATTGCATCCAGCAGTAACTCCATCACCACCAGCGCACACCATGGAGGTCTTAACTGTGCTTCCCCAATAGGCAAAGTTAGAGCAAGTGGAGTGGGCTACTGAAGGCAGAGGGGCTTGCTGCAAGATGGCGGGAAGTGGTCCATTGGTGACAGTCCTGCCCCATCCAGAAATAATGCAAGGGGAATTGTGAGCCAGAATTACTCCAGCATTGGGGAGAGTAGCCAGTTGCACGTTACTGTTCAAGGAGGCGCTGGAGGCCAGATAGAGCACAGCAATGTCAAACCCAGCAGCAACATTGTTTGGGTTCCAGTTGACGTGCTTCACAATTTGAGAAACAGCAATGATCTGCTCGGGGCCCTCGTTCACACTCAGATTGTGCTCACCCAGTATGACACGGAATGGTCCGGCTCTGTCCACACAGTGAGCAGCAGTCAAGACTCTGTCCGGGGCGGATCAAGGAACCTCCCCAAGTTATGGAAAAGCCCCTTGCCTGATTGGAATCTGGAGTGAAAACCTGCCAAGGGCCCAAAA
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGTTATTGTTGATCCAGTCGATGTAAGCAGAGACTCTGGTGAACACTGTGGGCTTCAGGTAAGCATTACATCCCAAGGAGGACACAAAACTGGTAACGCCGTGAACTTCATATACACCGTTGTTAGGACAGTTGAGGGGACCACCAGAATCTCCATTGCATCCAGCAGTAACTCCATCACCACCAGCGCACACCATGGAGGTCTTAACTGTGCTTCCCCAATAGGCAAAGTTAGAGCAAGTGGAGTGGGCTACTGAAGGCAGAGGGGCTTGCTGCAAGATGGCGGGAAGTGGTCCATTGGTGACAGTCCTGCCCCATCCAGAAATAATGCAAGGGGAATTGTGAGCCAGAATTACTCCAGCATTGGGGAGAGTAGCCAGTTGCACGTTACTGTTCAAGGAGGCGCTGGAGGCCAGATAGAGCACAGCAATGTCAAACCCAGCAGCAACATTGTTTGGGTTCCAGTTGACGTGCTTCACAATTTGAGAAACAGCAATGATCTGCTCGGGGCCCTCGTTCACACTCAGATTGTGCTCACCCAGTATGACACGGAATGGTCCGGCTCTGTCCACACAGTGAGCAGCAGTCAAGACTCTGTCCGGGGCGGATCAAGGAACCTCCCCAAGTTATGGAAAAGCCCCTTGCCTGATTGGAATCTGGAGTGAAAACCTGCCAAGGGCCCAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTTATTGTTGATCCAGTCG