ORFeome > cela2a ORF1 – XORFeome v1.0

cela2a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cela2a
Gene ID: 970282
Gene Page ID: 970277
ORF Xenbase ID: 17269053

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054304
Original XGC clone length: 723

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ839535
dbEST ID: 79657237
Trimmed Sequence: ATGAATCCACTGTTGGTGTTAGCGCTGTGCGTGGCTGGTGCCTACAGCTGTGGCGTGCCCACCTACCAGCCTGTTGTTTCCCGAGTGGTCAACGGGGAGGACACTGTCCCACACAGCTGGCCCTGGCAGGTTTCCCTGCAGTATCTCTATAATGGCTACTGGTATCACACATGTGGGGGGAGCCTTGTGGCATCCAACTGGGTTCTAACTGCGGCTCACTGTATCAGTTCATCCAATACTTACAGAGTGCAGCTCGGGAAACACAATCTCCGACAGGTTGAATCCGGACAGAAAACCATCAACGTCATCAAACTGATTAACCATTCCAAATGGAACCCAAACAGACTGTCCAATGGCTTTGATATCTCACTCATCAAATTGGAGGAAAGTGTGGAATCCACTGACACCATCCAACCTGCCTGTTTGCCCCCAGCTGGGTTCATCCTTCCACACCAATTTGGCTGCTATGTTACAGGCTGGGGCAATCTTCAAACCGGTGGCCCAGCCCCAGATAAGTTGCAGCAGGGACTTCTACTGGTGGTGGACCATGAAAACTGTTCCCAGCCGGACTGGGTGGGAAAGGAACGTACAGACCAACATGATCTGTGCTTGGTGGGGGATGGCATCATCTCAAGCTGTAATGGGGGACTCAGGAGGAACACTTAACTTCCGGAAACCCTGAATTGGGCTTGGAAAGGTCCATGAAAGTGGTCCATTTTTGGCTCATCCTTTCCAACTTTCCTTCCACCAATTTGGCATTTTAAAAAAAACATTTTTTTATAAAATTTTTTGCCCACCTNACCAGGGGTCCCAAAAAAAAAAAAAAAAA
Full Trace Sequence: GGGGCCCAAATAATAGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATCCACTGTTGGTGTTAGCGCTGTGCGTGGCTGGTGCCTACAGCTGTGGCGTGCCCACCTACCAGCCTGTTGTTTCCCGAGTGGTCAACGGGGAGGACACTGTCCCACACAGCTGGCCCTGGCAGGTTTCCCTGCAGTATCTCTATAATGGCTACTGGTATCACACATGTGGGGGGAGCCTTGTGGCATCCAACTGGGTTCTAACTGCGGCTCACTGTATCAGTTCATCCAATACTTACAGAGTGCAGCTCGGGAAACACAATCTCCGACAGGTTGAATCCGGACAGAAAACCATCAACGTCATCAAACTGATTAACCATTCCAAATGGAACCCAAACAGACTGTCCAATGGCTTTGATATCTCACTCATCAAATTGGAGGAAAGTGTGGAATCCACTGACACCATCCAACCTGCCTGTTTGCCCCCAGCTGGGTTCATCCTTCCACACCAATTTGGCTGCTATGTTACAGGCTGGGGCAATCTTCAAACCGGTGGCCCAGCCCCAGATAAGTTGCAGCAGGGACTTCTACTGGTGGTGGACCATGAAAACTGTTCCCAGCCGGACTGGGTGGGAAAGGAACGTACAGACCAACATGATCTGTGCTTGGTGGGGGATGGCATCATCTCAAGCTGTAATGGGGGACTCAGGAGGAACACTTAACTTCCGGAAACCCTGAATTGGGCTTGGAAAGGTCCATGAAAGTGGTCCATTTTTGGCTCATCCTTTCCAACTTTCCTTCCACCAATTTGGCATTTTAAAAAAAACATTTTTTTATAAAATTTTTTGCCCACCTNACCAGGGGTCCCAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATCCACTGTTGGTGTTAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839534
dbEST ID: 79657236
Trimmed Sequence: GGATGAGCCAAAACTGACCACTCCATGGACCTCCCAAGCCCCATCAGCGTTCCTGCAGTTAAGTGGTCCTCCTGAGTCCCCATTACAGCTTGAGATGATGCCATCCCCACCAGCACAGATCATGTTGGTCTGTACGTTCCTTCCCCACCAGTCCGGCTGGGAACAGTTTTCATGGTCCACCACCAGTAGAAGTCCCTGCTGCAACTTATCTGGGGCTGGGCCACCGGTTTGAAGATTGCCCCAGCCTGTAACATAGCAGCCAAATTGGTGTGGAAGGATGAACCCAGCTGGGGGCAAACAGGCAGGTTGGATGGTGTCAGTGGATTCCACACTTTCCTCCAATTTGATGAGTGAGATATCAAAGCCATTGGACAGTCTGTTTGGGTTCCATTTGGAATGGTTAATCAGTTTGATGACGTTGATGGTTTTCTGTCCGGATTCCACCTGTCCGAGATTGTGTTTCCCCAGCTGCACTCTGTAAGTATTGGATGAACTGATACAGTGAGCCCCAATTAGAACCCAGTTGGAATGCCACAAGGCTCCCCCCCCATGCTTTATACCCGTAGCCCTTATAGAAAATCCTGAGGGAAACCTGGCAAGGGCCAGCGTGGGGGGAAAAGGTTCTTCCCGGGTGACCACTCCGGAAACCAACCAGCCGGGAAAGGGGGACACCCCCACGCGCGTTAGGCCCCCACCCCCCCCAAGACCCCTAACCCCAACAGGGGGAATAATAGGCTGCCGATCTTTTTTTTGGGGACAAATTTTTGGCGGT
Full Trace Sequence: GAACAGGCTAATGACCATGGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGATGAGCCAAAACTGACCACTCCATGGACCTCCCAAGCCCCATCAGCGTTCCTGCAGTTAAGTGGTCCTCCTGAGTCCCCATTACAGCTTGAGATGATGCCATCCCCACCAGCACAGATCATGTTGGTCTGTACGTTCCTTCCCCACCAGTCCGGCTGGGAACAGTTTTCATGGTCCACCACCAGTAGAAGTCCCTGCTGCAACTTATCTGGGGCTGGGCCACCGGTTTGAAGATTGCCCCAGCCTGTAACATAGCAGCCAAATTGGTGTGGAAGGATGAACCCAGCTGGGGGCAAACAGGCAGGTTGGATGGTGTCAGTGGATTCCACACTTTCCTCCAATTTGATGAGTGAGATATCAAAGCCATTGGACAGTCTGTTTGGGTTCCATTTGGAATGGTTAATCAGTTTGATGACGTTGATGGTTTTCTGTCCGGATTCCACCTGTCCGAGATTGTGTTTCCCCAGCTGCACTCTGTAAGTATTGGATGAACTGATACAGTGAGCCCCAATTAGAACCCAGTTGGAATGCCACAAGGCTCCCCCCCCATGCTTTATACCCGTAGCCCTTATAGAAAATCCTGAGGGAAACCTGGCAAGGGCCAGCGTGGGGGGAAAAGGTTCTTCCCGGGTGACCACTCCGGAAACCAACCAGCCGGGAAAGGGGGACACCCCCACGCGCGTTAGGCCCCCACCCCCCCCAAGACCCCTAACCCCAACAGGGGGAATAATAGGCTGCCGATCTTTTTTTTGGGGACAAATTTTTGGCGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGAGCCAAAACTGAC