ORFeome > cenpl ORF1 – XORFeome v1.0

cenpl ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cenpl
Gene ID: 5736269
Gene Page ID: 5736185
ORF Xenbase ID: 17269113

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123318
Original XGC clone length: 1047

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ837253
dbEST ID: 79654955
Trimmed Sequence: ATGCAATCACCTTCTAATGGGGTTTCAACCCCAAAGGACTTCTCATCTGCAAGAAGAAGCATCCAGTTTCAAAATACTGGCTTCCCTCATATAGGCTTAGCCTCAGCACGAAGGCATACACCCTTCCATCATGCACCATCAAAGAGAAGGATCCACCAGACCAGTCCTTTATCAGAATCTGTTGATCCTGCAAAGGTCGCTCTCCTTCTTAGCAAGCAATGGACCCTATATAGTGTGACCCCAATGCACAAATTCTCATACACAAACTTAAAGGAGTATGCCAGGCTTCTGTCTGCCCACATCTGTGCTGAGAAGCAAAAGGGACTAGCAGTTGAGGTTGGCACAGAGTTGAACGTGAAAGCAACTTTCTCCCCCCTACCTGGGCTTAAGGGAAGAGAGCAAGATCCAGGATCTATTCTTGTTCAGGTTTTGGCGAAAGCTCCGCTTTCTGCAGCAGGTGCACAAGACCGCATTGTCTGGTCAGGCTGTTTTTGCTGTACTTTTGCAGACGAAGATACTTTAGACATGTTAACGTCAGAGACTCTTCTATGTCTTCCTTTATTCCTTGTAAATGGAGCAGAGACTCTTACAGCAATGGTGGGGACTTGGTTTCAAAAAGCTTTTGACTGTTCTTTCAGTAGTTTGCCAATCAGCTCTCGGGATCTTGCTTGGATGGCAGCGATGTGGACCGGCTATGAAGCACATGAACCTATCACAACCCACTGAATTTATCCTTTTCCGTGCCCCTCCAAACACATAATGGAAATATCATAATGCCATTTCTTCCCCAAAAAAATTAAAGGGCCCTTTTGGA
Full Trace Sequence: CGGGGCCCAAATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAATCACCTTCTAATGGGGTTTCAACCCCAAAGGACTTCTCATCTGCAAGAAGAAGCATCCAGTTTCAAAATACTGGCTTCCCTCATATAGGCTTAGCCTCAGCACGAAGGCATACACCCTTCCATCATGCACCATCAAAGAGAAGGATCCACCAGACCAGTCCTTTATCAGAATCTGTTGATCCTGCAAAGGTCGCTCTCCTTCTTAGCAAGCAATGGACCCTATATAGTGTGACCCCAATGCACAAATTCTCATACACAAACTTAAAGGAGTATGCCAGGCTTCTGTCTGCCCACATCTGTGCTGAGAAGCAAAAGGGACTAGCAGTTGAGGTTGGCACAGAGTTGAACGTGAAAGCAACTTTCTCCCCCCTACCTGGGCTTAAGGGAAGAGAGCAAGATCCAGGATCTATTCTTGTTCAGGTTTTGGCGAAAGCTCCGCTTTCTGCAGCAGGTGCACAAGACCGCATTGTCTGGTCAGGCTGTTTTTGCTGTACTTTTGCAGACGAAGATACTTTAGACATGTTAACGTCAGAGACTCTTCTATGTCTTCCTTTATTCCTTGTAAATGGAGCAGAGACTCTTACAGCAATGGTGGGGACTTGGTTTCAAAAAGCTTTTGACTGTTCTTTCAGTAGTTTGCCAATCAGCTCTCGGGATCTTGCTTGGATGGCAGCGATGTGGACCGGCTATGAAGCACATGAACCTATCACAACCCACTGAATTTATCCTTTTCCGTGCCCCTCCAAACACATAATGGAAATATCATAATGCCATTTCTTCCCCAAAAAAATTAAAGGGCCCTTTTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAATCACCTTCTAATGGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ837252
dbEST ID: 79654954
Trimmed Sequence: ATACTGTATATTATTTATTGCCAGCTCTGTGAGATATCCCAGCACTTGAAGTAAATATTCTTTGCTCAGAATCTTTACTTTACCATCACAGTGTGCTGATGCCACAGAGGTGGAGACCTTTACAAGATGAGTTGCTGATAAGTGGATCTTAAAATGCCGGAAAAAATGAGTATAGAGGCACTGAAAAAAAAGATCGACTTCTTCTGCCAAGACCTCATCTTGTCCTTTATGTATATTACTCCAAAGGGCCTTAATATCTTCTGGATGAATGGCATATGATATGTCCATATGTGGTTCGACTGGCACGGAAAAGATAAACTCAGTGGCTGTGATATGTTCATGTGCTTCATAGCCGGTCCACATCGCTGCCATCCAAGCAAGATCCCGAGAGCTGATTGGCAAACTACTGAAAGAACAGTCAAAAGCTTTTTGAAACCAAGTCCCCACCATTGCTGTAAGAGTCTCTGCTCCATTTACAAGGAATAAAGGAAGACATAGAAGAGTCTCTGACGTTAACATGTCTAAAGTATCTTCGTCTGCAAAAGTACAACAGAAACAGCCTGACCAGACCATGCGGTCTTGTGCACCTGCTGCAAAAGCGGAACTTTCCCCAAAACTGAACAAAATTAGATCCTGGATCTTGCTCTCTTCCCTTAACCCCCGGTAGGGGGGAAGAAGTTTGCT
Full Trace Sequence: GGTAAACGGCTTATGACCATGTAATACGACTCACTACTAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATACTGTATATTATTTATTGCCAGCTCTGTGAGATATCCCAGCACTTGAAGTAAATATTCTTTGCTCAGAATCTTTACTTTACCATCACAGTGTGCTGATGCCACAGAGGTGGAGACCTTTACAAGATGAGTTGCTGATAAGTGGATCTTAAAATGCCGGAAAAAATGAGTATAGAGGCACTGAAAAAAAAGATCGACTTCTTCTGCCAAGACCTCATCTTGTCCTTTATGTATATTACTCCAAAGGGCCTTAATATCTTCTGGATGAATGGCATATGATATGTCCATATGTGGTTCGACTGGCACGGAAAAGATAAACTCAGTGGCTGTGATATGTTCATGTGCTTCATAGCCGGTCCACATCGCTGCCATCCAAGCAAGATCCCGAGAGCTGATTGGCAAACTACTGAAAGAACAGTCAAAAGCTTTTTGAAACCAAGTCCCCACCATTGCTGTAAGAGTCTCTGCTCCATTTACAAGGAATAAAGGAAGACATAGAAGAGTCTCTGACGTTAACATGTCTAAAGTATCTTCGTCTGCAAAAGTACAACAGAAACAGCCTGACCAGACCATGCGGTCTTGTGCACCTGCTGCAAAAGCGGAACTTTCCCCAAAACTGAACAAAATTAGATCCTGGATCTTGCTCTCTTCCCTTAACCCCCGGTAGGGGGGAAGAAGTTTGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATACTGTATATTATTTATTGCCAG