ORFeome > cetn3 ORF1 – XORFeome v1.0

cetn3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cetn3
Gene ID: 1001059
Gene Page ID: 1001053
ORF Xenbase ID: 17269251

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129790
Original XGC clone length: 504

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11093
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ838978
dbEST ID: 79656680
Trimmed Sequence: ATGAGCCTGGCTGTGAGGACTGATGTAGCAGTTGACAAAATGAAACGAAAGAAAAGAAGAGAATTGACAGAAAAACAAAAACAAGAAATCAAAGATGCATTTGAATTATTCGATACCGATAAAGATAAAGCCATAGATTATCATGAATTAAAGGTAGCCATGAGAGCTCTCGGATTTGATGTGAAGAAAGCAGATGTTCTAAAAATCCTTAAAGACTATGATGGTGAAACAACAGGCAAAATTACATTTGATGATTTTAATGAAGTTGTCACAGACTTAATACTTGACCGGGATCCACAAGAGGAAATTCTGAAAGCTTTTAAATTATTTGACGATGACGACTCCGGCAAAATAAGCTTAAGAAATCTTCGTCGGGTTGCAAGAGAACTCGGGGAAACAATGGCAGATGAAGAATTGCGTGCCATGATTGAGGAGTTTGATAAGGATGGAGATGGAGAAATAAATCAAGAGGAATTCCTTTCCATAATGACCGGAGATCTTTT
Full Trace Sequence: TCGAGGCCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCTGGCTGTGAGGACTGATGTAGCAGTTGACAAAATGAAACGAAAGAAAAGAAGAGAATTGACAGAAAAACAAAAACAAGAAATCAAAGATGCATTTGAATTATTCGATACCGATAAAGATAAAGCCATAGATTATCATGAATTAAAGGTAGCCATGAGAGCTCTCGGATTTGATGTGAAGAAAGCAGATGTTCTAAAAATCCTTAAAGACTATGATGGTGAAACAACAGGCAAAATTACATTTGATGATTTTAATGAAGTTGTCACAGACTTAATACTTGACCGGGATCCACAAGAGGAAATTCTGAAAGCTTTTAAATTATTTGACGATGACGACTCCGGCAAAATAAGCTTAAGAAATCTTCGTCGGGTTGCAAGAGAACTCGGGGAAACAATGGCAGATGAAGAATTGCGTGCCATGATTGAGGAGTTTGATAAGGATGGAGATGGAGAAATAAATCAAGAGGAATTCCTTTCCATAATGACCGGAGATCTTTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAAAAAACATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAAAAAAACATTATTTGCCATCCGCCTAATATCCCCAACAATGAAGCGTATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTCAAATCCCCTAAAGTTAAACAAAAAANNTCNNNTAGCCGNNNNGTGGANGGNNTCGAGGGGTCGAAATTTCGAAAACAATGNAGCGGCCAAACACACCCCCCCCCCGCCCAGACCCGGGGGAAAAAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCTGGCTGTGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838977
dbEST ID: 79656679
Trimmed Sequence: AAGATCTCCGGTCATTATGGAAAGGAATTCCTCTTGATTTATTTCTCCATCTCCATCCTTATCAAACTCCTCAATCATGGCACGCAATTCTTCATCTGCCATTGTTTCCCCGAGTTCTCTTGCAACCCGACGAAGATTTCTTAAGCTTATTTTGCCGGAGTCGTCATCGTCAAATAATTTAAAAGCTTTCAGAATTTCCTCTTGTGGATCCCGGTCAAGTATTAAGTCTGTGACAACTTCATTAAAATCATCAAATGTAATTTTGCCTGTTGTTTCACCATCATAGTCTTTAAGGATTTTTAGAACATCTGCTTTCTTCACATCAAATCCGAGAGCTCTCATGGCTACCTTTAATTCATGATAATCTATGGCTTTATCTTTATCGGTATCGAATAATTCAAATGCATCTTTGATTTCTTGTTTTTGTTCTTCTGTCAATTCTCTTCTTTTCTTTCGTTTCATTTTGTCAACTGCTACCTCAGTCCTCACAGCCCGGGCTCATGG
Full Trace Sequence: GTGCAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGATCTCCGGTCATTATGGAAAGGAATTCCTCTTGATTTATTTCTCCATCTCCATCCTTATCAAACTCCTCAATCATGGCACGCAATTCTTCATCTGCCATTGTTTCCCCGAGTTCTCTTGCAACCCGACGAAGATTTCTTAAGCTTATTTTGCCGGAGTCGTCATCGTCAAATAATTTAAAAGCTTTCAGAATTTCCTCTTGTGGATCCCGGTCAAGTATTAAGTCTGTGACAACTTCATTAAAATCATCAAATGTAATTTTGCCTGTTGTTTCACCATCATAGTCTTTAAGGATTTTTAGAACATCTGCTTTCTTCACATCAAATCCGAGAGCTCTCATGGCTACCTTTAATTCATGATAATCTATGGCTTTATCTTTATCGGTATCGAATAATTCAAATGCATCTTTGATTTCTTGTTTTTGTTCTTCTGTCAATTCTCTTCTTTTCTTTCGTTTCATTTTGTCAACTGCTACCTCAGTCCTCACAGCCCGGGCTCATGGTGCCAACTTTTTTGTACAAAGTTTGGCATTATAAAAAAGCATTTGCTCATCATTTTGTGGAACGAACAGGTGCATATCAGTCCAAATAAAATCAAAAAAAAAAAAAAAAAAGAAAAACAGGACGTGTTTTACAACGAACAAAACATGGNGNNNNAGGGGGGANNNNGAGGNGGGNGGGGGGGGGAAGGGNGGGGGGGGGGGGAAGGGGGGGGAAGAGGGAGGGAGTGGAGGGNGNGGNGNGNNNTGAGGGNNGAAAAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGATCTCCGGTCATTATGGAA