ORFeome > cfd ORF1 – XORFeome v1.0

cfd ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cfd
Gene ID: 973610
Gene Page ID: 973604
ORF Xenbase ID: 17269269

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082912
Original XGC clone length: 792

Human orthology & disease relationships

NCBI Entrez ID: 1675
Ensembl gene IDs: ENSG00000197766,ENSG00000274619,LRG_46
Directly associated (OMIM) disease MIM numbers: 613912
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ839661
dbEST ID: 79657363
Trimmed Sequence: ATGAATATCTCCAGGGTTCTGTTTGCGGTGGTCCTGGTACTAACTGTTTCCACCTATGAATGCAGGCCACGTGGGCGTATTCTAGGTGGGCAAGATTCAAAGGAAAAAACCTGGCCTTTTATGGCATCTATTCAGAAGAATGAGGTCCACCAATGTGGGGGGGTCCTTATTTCTGATAAATGGGTGCTGAGTGCAGCACACTGTGCTACTGACAGCAATAATTCATCACTGCATGTGATGCTTGGCGCCATCTCTCTCACCAAACCAGAGCAATACAAAATAGTTTTAAAGGTGGAAAGGGAGATCCCTCACCCTCTGTACAATTCTACCAAAAAGCATCATGATCTTCTCCTGCTAGAGCTATCTGAAAAAGTAACATTAAGCGAAGCTGTGAAGCCCCTGCCTTTTGAAACTGAAAATATTGACATCCCTGATGGAAAACGATGCCTAGTCGCAGGTTGGGGACAGATGAAATCAACTGGAAAGAAGCCAGACACTTTGCAAGAATTATGGATCCCCGTGATTAGCAGGGATGTCTGTAATCGCCGGAACTACTATGATAATGAAATTACCCCAAATATGATATGTGCTATAGAAGCCAAGAAGGACTCATGTGAAGGAGACTCCGGGGGACCTCTAGTATGTGATGGAATAGCAGTGGCTATTGGTACAGGCGGATATCGTAAATGTGGCCTATCGAAAAAACCAGGCATCTACCCATTCATTTCACCTTTACAACTCCGGAAAATGGAAAACAAGTAAAAAAGCTACTCCACCTCCCCCTCCCCCTTTGTTCCCCAACTTTTTCTGGTACAAAAG
Full Trace Sequence: CGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAATATCTCCAGGGTTCTGTTTGCGGTGGTCCTGGTACTAACTGTTTCCACCTATGAATGCAGGCCACGTGGGCGTATTCTAGGTGGGCAAGATTCAAAGGAAAAAACCTGGCCTTTTATGGCATCTATTCAGAAGAATGAGGTCCACCAATGTGGGGGGGTCCTTATTTCTGATAAATGGGTGCTGAGTGCAGCACACTGTGCTACTGACAGCAATAATTCATCACTGCATGTGATGCTTGGCGCCATCTCTCTCACCAAACCAGAGCAATACAAAATAGTTTTAAAGGTGGAAAGGGAGATCCCTCACCCTCTGTACAATTCTACCAAAAAGCATCATGATCTTCTCCTGCTAGAGCTATCTGAAAAAGTAACATTAAGCGAAGCTGTGAAGCCCCTGCCTTTTGAAACTGAAAATATTGACATCCCTGATGGAAAACGATGCCTAGTCGCAGGTTGGGGACAGATGAAATCAACTGGAAAGAAGCCAGACACTTTGCAAGAATTATGGATCCCCGTGATTAGCAGGGATGTCTGTAATCGCCGGAACTACTATGATAATGAAATTACCCCAAATATGATATGTGCTATAGAAGCCAAGAAGGACTCATGTGAAGGAGACTCCGGGGGACCTCTAGTATGTGATGGAATAGCAGTGGCTATTGGTACAGGCGGATATCGTAAATGTGGCCTATCGAAAAAACCAGGCATCTACCCATTCATTTCACCTTTACAACTCCGGAAAATGGAAAACAAGTAAAAAAGCTACTCCACCTCCCCCTCCCCCTTTGTTCCCCAACTTTTTCTGGTACAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATATCTCCAGGGTTCTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839660
dbEST ID: 79657362
Trimmed Sequence: CAAAGGGGATGGGAGTAGAGTAGCATTATACATGGTTTCCATTATCCAGGATTTGTAAGGTGCAATGAGTGTGTAGATGCCTGGCTTCTTCGATAGGCCACATCTACGATATCCGCCCTGTACAATAGCCACTGCTATTCCATCACATACTAGAGGTCCCCCGGAGTCTCCCTCACATGAGTCCTTCTTGGCTTCTATAGCACATATCATATTTGGGGTAATTTCATTATCATAGTAGTTCCGGCGATTACAGACATCCCTGCTAATCACGGGGATCCATAATTCTTGCAAAGTGTCTGGCTTCTTTCCAGTTGATTTCATCTGTCCCCAACCTGCGACTAGGCATCGTTTTCCATCAGGGATGTCAATATTTTCAGTTTCAAAAGGCAGGGGCTTCACAGCTTCGCTTAATGTTACTTTTTCAGATAGCTCTAGCAGGAGAAGATCATGATGCTTTTTGGTAGAATTGTACAGAGGGTGAGGGATCTCCCTTTCCACCTTCAAAACTATTTTGTATTGCTCTGGTTTGGTGAGAGAGATGGCGCCGGGCATCACATGCAGTGATGAATTATGGCTGTCAGTAGCACAGTGTGCTGCACTCAGCACCCCTTTATCCAAAATAAGGACCCCGCCACATTGCTGGACCTCCTTCTTCCTAAAAAGATCCCCAAAAAAAGCCCAGGTTTGTTCCTTTTAAATCCCTGCCCATCCTAAAAAACCGCCCACCCTGGCCCGGCTTTCATAGGGGTGGAAAGAGGGTTGTTAAACAGGGAAACCCCCG
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAGGGGATGGGAGTAGAGTAGCATTATACATGGTTTCCATTATCCAGGATTTGTAAGGTGCAATGAGTGTGTAGATGCCTGGCTTCTTCGATAGGCCACATCTACGATATCCGCCCTGTACAATAGCCACTGCTATTCCATCACATACTAGAGGTCCCCCGGAGTCTCCCTCACATGAGTCCTTCTTGGCTTCTATAGCACATATCATATTTGGGGTAATTTCATTATCATAGTAGTTCCGGCGATTACAGACATCCCTGCTAATCACGGGGATCCATAATTCTTGCAAAGTGTCTGGCTTCTTTCCAGTTGATTTCATCTGTCCCCAACCTGCGACTAGGCATCGTTTTCCATCAGGGATGTCAATATTTTCAGTTTCAAAAGGCAGGGGCTTCACAGCTTCGCTTAATGTTACTTTTTCAGATAGCTCTAGCAGGAGAAGATCATGATGCTTTTTGGTAGAATTGTACAGAGGGTGAGGGATCTCCCTTTCCACCTTCAAAACTATTTTGTATTGCTCTGGTTTGGTGAGAGAGATGGCGCCGGGCATCACATGCAGTGATGAATTATGGCTGTCAGTAGCACAGTGTGCTGCACTCAGCACCCCTTTATCCAAAATAAGGACCCCGCCACATTGCTGGACCTCCTTCTTCCTAAAAAGATCCCCAAAAAAAGCCCAGGTTTGTTCCTTTTAAATCCCTGCCCATCCTAAAAAACCGCCCACCCTGGCCCGGCTTTCATAGGGGTGGAAAGAGGGTTGTTAAACAGGGAAACCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAGGGGATGGGAGTAGA