ORFeome > cfl1 ORF1 – XORFeome v1.0

cfl1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cfl1
Gene ID: 6251620
Gene Page ID: 1016480
ORF Xenbase ID: 17269275

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043803
Original XGC clone length: 507

Human orthology & disease relationships

NCBI Entrez ID: 1072
Ensembl gene IDs: ENSG00000172757
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 182290,215600,600652,603278,607841

Library Location

Plate ID: GDExl11012
Well Location: E12

Sequences - 5ʹ (forward) EST

Accession: JZ824008
dbEST ID: 79641710
Trimmed Sequence: ATGGCCTCTGGTGTGATGGTCTCGGATGATGTCGTTAAAGTATTTAATGATATGAAGGTGCGCCATCAACTCTCCCCAGAAGAAGCCAAGAAACGCAAGAAGGCCGTTATCTTTTGTCTTAGTGACGACAAGAAAACAATCATTTTGGAACCAGGAAAGGAGATCTTGCAAGGAGATGTCGGTTGTAATGTGGAAGACCCCTACAAGACCTTTGTGAAGATGCTGCCCCGGAACGACTGCCGTTACGCACTGTATGATGCACTCTACGAGACAAAAGAAACCAAAAAAGAGGATCTTGTTTTTGTGTTCTGGGCCCCTGAAGAAGCGTCACTGAAAAGTAAAATGATCTACGCTAGCTCAAAAGATGCAATCAGGAAGAGATTTACAGGTATCAAACACGAGTGGCAAACAAACACGTACGATGATATAAACGATCCCTGTAACCTTGCAGATAAACTAGGTGGCAACACTGTAGTTTCCCTTGAAGGAAAATCCCTGAGAAGCTT
Full Trace Sequence: CCAGTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCTCTGGTGTGATGGTCTCGGATGATGTCGTTAAAGTATTTAATGATATGAAGGTGCGCCATCAACTCTCCCCAGAAGAAGCCAAGAAACGCAAGAAGGCCGTTATCTTTTGTCTTAGTGACGACAAGAAAACAATCATTTTGGAACCAGGAAAGGAGATCTTGCAAGGAGATGTCGGTTGTAATGTGGAAGACCCCTACAAGACCTTTGTGAAGATGCTGCCCCGGAACGACTGCCGTTACGCACTGTATGATGCACTCTACGAGACAAAAGAAACCAAAAAAGAGGATCTTGTTTTTGTGTTCTGGGCCCCTGAAGAAGCGTCACTGAAAAGTAAAATGATCTACGCTAGCTCAAAAGATGCAATCAGGAAGAGATTTACAGGTATCAAACACGAGTGGCAAACAAACACGTACGATGATATAAACGATCCCTGTAACCTTGCAGATAAACTAGGTGGCAACACTGTAGTTTCCCTTGAAGGAAAATCCCTGAGAAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAGCATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCGTGCCAATAATTAAATAAAAAAAAAAAAAAAAANNNNTNNNNNNNNNNNTTTTTTTTTTTTTTTATTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCTCTGGTGTGATGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829316
dbEST ID: 79647018
Trimmed Sequence: GCTTCTCAGGGATTTTCCTTCAAGGGAAACTACAGTGTTGCCACCTAGTTTATCTGCAAGGTTACAGGGATCGTTTATATCATCGTACGTGTTTGTTTGCCACTCGTGTTTGATACCTGTAAATCTCTTCCTGATTGCATCTTTTGAGCTAGCGTAGATCATTTTACTTTTCAGTGACGCTTCTTCAGGGGCCCAGAACACAAAAACAAGATCCTCTTTTTTGGTTTCTTTTGTCTCGTAGAGTGCATCATACAGTGCGTAACGGCAGTCGTTCCGGGGCAGCATCTTCACAAAGGTCTTGTAGGGGTCTTCCACATTACAACCGACATCTCCTTGCAAGATCTCCTTTCCTGGTTCCAAAATGATTGTTTTCTTGTCGTCACTAAGACAAAAGATAACGGCCTTCTTGCGTTTCTTGGCTTCTTCTGGGGAGAGTTGATGGCGCACCTTCATATCATTAAATACTTTAACGACATCATCCGAGACCATCACACCAGAGGCCATGG
Full Trace Sequence: CTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTCTCAGGGATTTTCCTTCAAGGGAAACTACAGTGTTGCCACCTAGTTTATCTGCAAGGTTACAGGGATCGTTTATATCATCGTACGTGTTTGTTTGCCACTCGTGTTTGATACCTGTAAATCTCTTCCTGATTGCATCTTTTGAGCTAGCGTAGATCATTTTACTTTTCAGTGACGCTTCTTCAGGGGCCCAGAACACAAAAACAAGATCCTCTTTTTTGGTTTCTTTTGTCTCGTAGAGTGCATCATACAGTGCGTAACGGCAGTCGTTCCGGGGCAGCATCTTCACAAAGGTCTTGTAGGGGTCTTCCACATTACAACCGACATCTCCTTGCAAGATCTCCTTTCCTGGTTCCAAAATGATTGTTTTCTTGTCGTCACTAAGACAAAAGATAACGGCCTTCTTGCGTTTCTTGGCTTCTTCTGGGGAGAGTTGATGGCGCACCTTCATATCATTAAATACTTTAACGACATCATCCGAGACCATCACACCAGAGGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTAAAAAAAAGCATTGCTCATCAATTTGTTGGCACGAACAGGGTCACTATCAAGTCAAAATAAAAATCATTAAATAAAGACCCGAGCTTTAAAACGGGGCGGTCGGTTTACACGGCTCGTGGGCAGGGGGAAGTGTACAGGGGGGGGTCGGGGGCGGTGTGTCCCCAAGCGTGGTGAAAAAGAAAAGCGGAGGGGGGATGGGAGGGGAGATTTTCGGGGTAGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTCTCAGGGATTTTCCTT