ORFeome > cfp ORF1 – XORFeome v1.0

cfp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cfp
Gene ID: 5941338
Gene Page ID: 5941220
ORF Xenbase ID: 17269293

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077925
Original XGC clone length: 1344

Human orthology & disease relationships

NCBI Entrez ID: 5199
Ensembl gene IDs: ENSG00000126759,LRG_129
Directly associated (OMIM) disease MIM numbers: 312060
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11041
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ827932
dbEST ID: 79645634
Trimmed Sequence: ATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAAAGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGGCAATGGGGTCTGTGGGGTCCATGCTCCGAATCCTGCACCAACGGAAGTTCCGGAATTTCCCTGTTCAAACTCGCCAAGCGCCAGTGCACAACCCGTTCCCCTCCCTCATTCCACAAGGAAGGCGGTGTGGCCAGGAATCCCAACAAATTCAAAAAGGCACCCTCCTTTCCTTCCGGCCCATTTTTTGGGAGTTTGGGGGGCCCGGGCAAGCCCAAACTTCTTAATTTTTTCGGTCCCTTTTTCCGGCATTT
Full Trace Sequence: GGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCGTCGTGCGTGTAGCTCTGCTGTTGGCTCTCGGGGCCCTCCTGCCATTCTCAGTGTCGGAGGAAGTTGTGTGTTACAGTGACTTTGACGAGAGGTCGGGGGGCTGCACTCAGTACCTCGGGGAAGGGGTGAGTGAGGGCGACTGCTGCCTGAATATCAAGTACAGCTTCAAGCGGGACCCCGGGGCCCCCTGCGAGTCCTGCCGTCCTGCGGAATGGAGCGAAAGGAGCCTCTGGAGCCCTTGTACTGTGTCCTGTCTGGATGGGGTTCAGAGAAGAGATAGGGTCTGCACAGGTCAAGGGGACTGCCAGGGTAACAAGGTGGAGGTCAGAGCCTGTTCCCTGCAGAACTGCTGCCCAGAGACTGGAGGTTGGTCTTCATGGTCCGCATGGACGGTGTGTTCCGTGACCTGCGCAGAGGGAACAAAGCAGAGAACCCGCAAATGCGACAGCCCAAGCCCTCAGTGCGGCGGATCCTGTGCTGGGAGTTCAGTGGAAAAGGTTAATTGTAACACCCAGCAGGTTTGCCCCACACACGGGGCCTGGGGGCAATGGGGTCTGTGGGGTCCATGCTCCGAATCCTGCACCAACGGAAGTTCCGGAATTTCCCTGTTCAAACTCGCCAAGCGCCAGTGCACAACCCGTTCCCCTCCCTCATTCCACAAGGAAGGCGGTGTGGCCAGGAATCCCAACAAATTCAAAAAGGCACCCTCCTTTCCTTCCGGCCCATTTTTTGGGAGTTTGGGGGGCCCGGGCAAGCCCAAACTTCTTAATTTTTTCGGTCCCTTTTTCCGGCATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGTCGTGCGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ827931
dbEST ID: 79645633
Trimmed Sequence: GCACTCAATCACATTCTTACACTCCTCCTTCTCCTCCACCTTCTTGGTCTGCTTGTTGATGGGGTCACATCGCACTCTGGGGGGTCCCATAGAAAAACACGTCCACTAACTTGCCCGTCTGAGTGAGGGTGGTCTCCGGGTAGTCGGGGTACACCGGCTGGCACACCCTTTCACTTGTTCTCACTGATTTGCCACAAGGAGGGGAGCACAGGCCCCACTCGCCCCACTCTGACCACTTTTCATCCAAGGAACACCCGTCCACGTTGTAACAATTGCGGCTCTCCCTGTGGTGGGACTCGCACCATTTCCCCCCGTATTTCTCTCCTTCGCACTCCCGTTTCCTGTTCTGGGTCCCCACTTTGGTGGAGCACGCTATATTCTCCTGCAAACGGGCACACGGGCTCCAAGGCTGCCACTGGCTCCACTTCCCATCGACTGGACAGCCCACCTTTGTATTGCACATAAATTGCCGGGTGTTGGATCCCTCACAATGTCCCCCACCATATTTGGGGGCCGGGGAATCACAGAAGCCGCTTTTCTCTGATCCCTCCAATGCCGCACGTGGACAAAACATCAGAGTCTGGCTCGCCAGCCCCCCGACCTTCCGCCAACTGGGCAGAAGGCCAAAAAAAGTGCAGTCTTGGAACTTGTCGGGATTCCTGGCCCACACGCCCTTCCTTGGTCCCCCAAAGGAAAGGTTAACGGGGGTGGTTGCCCCTGGGCGCCTGTCCAAAATTTGAAAACAAGGGAAAAAATTCCCCG
Full Trace Sequence: AGGGCAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCACTCAATCACATTCTTACACTCCTCCTTCTCCTCCACCTTCTTGGTCTGCTTGTTGATGGGGTCACATCGCACTCTGGGGGGTCCCATAGAAAAACACGTCCACTAACTTGCCCGTCTGAGTGAGGGTGGTCTCCGGGTAGTCGGGGTACACCGGCTGGCACACCCTTTCACTTGTTCTCACTGATTTGCCACAAGGAGGGGAGCACAGGCCCCACTCGCCCCACTCTGACCACTTTTCATCCAAGGAACACCCGTCCACGTTGTAACAATTGCGGCTCTCCCTGTGGTGGGACTCGCACCATTTCCCCCCGTATTTCTCTCCTTCGCACTCCCGTTTCCTGTTCTGGGTCCCCACTTTGGTGGAGCACGCTATATTCTCCTGCAAACGGGCACACGGGCTCCAAGGCTGCCACTGGCTCCACTTCCCATCGACTGGACAGCCCACCTTTGTATTGCACATAAATTGCCGGGTGTTGGATCCCTCACAATGTCCCCCACCATATTTGGGGGCCGGGGAATCACAGAAGCCGCTTTTCTCTGATCCCTCCAATGCCGCACGTGGACAAAACATCAGAGTCTGGCTCGCCAGCCCCCCGACCTTCCGCCAACTGGGCAGAAGGCCAAAAAAAGTGCAGTCTTGGAACTTGTCGGGATTCCTGGCCCACACGCCCTTCCTTGGTCCCCCAAAGGAAAGGTTAACGGGGGTGGTTGCCCCTGGGCGCCTGTCCAAAATTTGAAAACAAGGGAAAAAATTCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACTCAATCACATTCTTACACT