ORFeome > cg10992 ORF1 – XORFeome v1.0

cg10992 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6254073
Gene Page ID:
ORF Xenbase ID: 17269299

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046667
Original XGC clone length: 1002

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11012
Well Location: C01

Sequences - 5ʹ (forward) EST

Accession: JZ823919
dbEST ID: 79641621
Trimmed Sequence: ATGTGGCATCTTGTAGTTGCACTCTGCTTCCTGGCCTCCATCGCCAATTCCCGCCATCTCCCCTACTTTGCCCCCTTGTCGCACGATATGGTGAATTATATCAACAAGGTCAACACTACATGGAAGGCTGGGCACAACTTTGCTAATGCTGATGTACACTATGTGAAACGGCTCTGTGGAACACACCTTAATGGCCCCCAGCTTCAAAAGAGGTTTGGGTTTGCTGATGACCTAGACCTTCCAGACAGCTTTGATTCCCGGGCAGCTTGGCCCAACTGTCCCACCATCCGGGAGATCCGAGATCAGGGATCATGCGGCTCTTGCTGGGCGTTTGGTGCGGTTGAAGCCATCTCTGATCGTGTTTGTGTTCACACCAATGGGAAGGTGAACGTGGAGGTGTCTGCTGAAGATCTCCTGTCCTGCTGTGGCTTTAAATGTGGCATGGGCTGTAATGGAGGGTATCCATCTGGAGCCTGGCGATTCTGGACTGAGACCGGTTTGGTTTCCGGGGGCTTGTATGACTCCCATGTTGGCTGCAGGCCGTACTCTATCCCTCCCTGCGAGCACCATGTGAATGGCTCCAGGCCGTCCTGCAAGGNGGAAGAGGGCGATACCCCAAAGTGCATGAAGACGTGCGAGGAAGGCTACACCCCAGCCTATGGCAGTGACAAACATTTCGGAGCCACCTCCTACGGTGTTCCNAGCAGTGAGAAGGAAATCATGGCTGATATCTACAAGAACGGCCCNAGTTGAGGGGAGCTTTTGTGGTCTATGCAGACTTTCCACTGTTACAAAATCGGGTGTGTTACCAACATTTAAACCCGGA
Full Trace Sequence: CAGTAGTGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGCATCTTGTAGTTGCACTCTGCTTCCTGGCCTCCATCGCCAATTCCCGCCATCTCCCCTACTTTGCCCCCTTGTCGCACGATATGGTGAATTATATCAACAAGGTCAACACTACATGGAAGGCTGGGCACAACTTTGCTAATGCTGATGTACACTATGTGAAACGGCTCTGTGGAACACACCTTAATGGCCCCCAGCTTCAAAAGAGGTTTGGGTTTGCTGATGACCTAGACCTTCCAGACAGCTTTGATTCCCGGGCAGCTTGGCCCAACTGTCCCACCATCCGGGAGATCCGAGATCAGGGATCATGCGGCTCTTGCTGGGCGTTTGGTGCGGTTGAAGCCATCTCTGATCGTGTTTGTGTTCACACCAATGGGAAGGTGAACGTGGAGGTGTCTGCTGAAGATCTCCTGTCCTGCTGTGGCTTTAAATGTGGCATGGGCTGTAATGGAGGGTATCCATCTGGAGCCTGGCGATTCTGGACTGAGACCGGTTTGGTTTCCGGGGGCTTGTATGACTCCCATGTTGGCTGCAGGCCGTACTCTATCCCTCCCTGCGAGCACCATGTGAATGGCTCCAGGCCGTCCTGCAAGGNGGAAGAGGGCGATACCCCAAAGTGCATGAAGACGTGCGAGGAAGGCTACACCCCAGCCTATGGCAGTGACAAACATTTCGGAGCCACCTCCTACGGTGTTCCNAGCAGTGAGAAGGAAATCATGGCTGATATCTACAAGAACGGCCCNAGTTGAGGGGAGCTTTTGTGGTCTATGCAGACTTTCCACTGTTACAAAATCGGGTGTGTTACCAACATTTAAACCCGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCATCTTGTAGTTGCACTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829228
dbEST ID: 79646930
Trimmed Sequence: GTTTTTGGGAATTCCAGCAACAACCTCGGACTCAATCCCGCAGTGATCCTTGCCACGCAGAATCTTGAAGAAGCCATTATCACCCCAGTCTGTGTTCCAGGAGTTTGCACACAACCAATAGGGGGTTCCATTTTCCACACCCCAACCCAGGATCTTAATAGCATGACCTCCAAGTTCTTCTCCGGTTTCATGTTGGTACACACCCGATTTGTACAGTGGAAAGTCTGCATAGACCACAAAAGCTCCCTCAACTGGGCCGTTCTTGTAGATATCAGCCATGATTTCCTTCTCACTGCTTGGAACACCGTAGGAGGTGGCTCCGAAATGTTTGTCACTGCCATAGGCTGGGGTGTAGCCTTCCTCGCACGTCTTCATGCACTTTGGGGTATCGCCCTCTTCCCCCTTGCAGGACGGCCTGGAGCCATTCACATGGTGCTCGCAGGGAGGGATAGAGTACGGCCTGCAGCCAACATGGGAGTCATACAAGCCCCCGGAAACCAAACCGGTCTCAGTCCAGAATCGCCAGGCTCCAGATGGATACCCTCCATTACAGCCCATGCCACATTTAAGGCCACAGCAGGACAGGAGATCTTCAGCAGACACCTCCCCGTTCACCCTTCCCATTGGTGTGAACACAAACACGATCAGA
Full Trace Sequence: CCTGGCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTTGGGAATTCCAGCAACAACCTCGGACTCAATCCCGCAGTGATCCTTGCCACGCAGAATCTTGAAGAAGCCATTATCACCCCAGTCTGTGTTCCAGGAGTTTGCACACAACCAATAGGGGGTTCCATTTTCCACACCCCAACCCAGGATCTTAATAGCATGACCTCCAAGTTCTTCTCCGGTTTCATGTTGGTACACACCCGATTTGTACAGTGGAAAGTCTGCATAGACCACAAAAGCTCCCTCAACTGGGCCGTTCTTGTAGATATCAGCCATGATTTCCTTCTCACTGCTTGGAACACCGTAGGAGGTGGCTCCGAAATGTTTGTCACTGCCATAGGCTGGGGTGTAGCCTTCCTCGCACGTCTTCATGCACTTTGGGGTATCGCCCTCTTCCCCCTTGCAGGACGGCCTGGAGCCATTCACATGGTGCTCGCAGGGAGGGATAGAGTACGGCCTGCAGCCAACATGGGAGTCATACAAGCCCCCGGAAACCAAACCGGTCTCAGTCCAGAATCGCCAGGCTCCAGATGGATACCCTCCATTACAGCCCATGCCACATTTAAGGCCACAGCAGGACAGGAGATCTTCAGCAGACACCTCCCCGTTCACCCTTCCCATTGGTGTGAACACAAACACGATCAGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTGGGAATTCCAGCAACA