ORFeome > chchd4 ORF1 – XORFeome v1.0

chchd4 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: chchd4
Gene ID: 6255306
Gene Page ID: 968361
ORF Xenbase ID: 17269335

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082911
Original XGC clone length: 420

Human orthology & disease relationships

NCBI Entrez ID: 131474
Ensembl gene IDs: ENSG00000163528
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 121850,137800,153480,158350,176807,176920,276950,300555,309000

Library Location

Plate ID: GDExl11005
Well Location: H04

Sequences - 5ʹ (forward) EST

Accession: JZ839862
dbEST ID: 79657564
Trimmed Sequence: ATGTCCTACTGCAGGCAGGAAGGAAAGGACAAAATCATTTTTGTAACCAAGGAGGACCATGAAACTCCCAGTAATGGCAGAGCTGATTGCAGATGATCCAAATGACCCTTTTGAGGAACAAGGGCTGATCTTGCCAAATGGAGACATCAATTGGAACTGCCCGTGCCTTGGAGGCATGGCCAGTGGTCCTTGTGGGGAGCAGTTTAAGTCGGCTTTCTCTTGCTTTCACTACAGTCAGGAGGAGATAAAGGGCTCGGACTGCCTAGATCAGTTCCGGGCAATGCAAGAATGCATGCAGAAATACCCCGAATTATATCCACAGGAGGATGATGAGGATGAACTGGAGAAAGAGAAGCAGAATAAAGACGAAGAGTCTTCCGTCACACAGTCCTCCGATACCAAAGAAGAGAGTTCCAGCTT
Full Trace Sequence: CGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCTACTGCAGGCAGGAAGGAAAGGACAAAATCATTTTTGTAACCAAGGAGGACCATGAAACTCCCAGTAATGGCAGAGCTGATTGCAGATGATCCAAATGACCCTTTTGAGGAACAAGGGCTGATCTTGCCAAATGGAGACATCAATTGGAACTGCCCGTGCCTTGGAGGCATGGCCAGTGGTCCTTGTGGGGAGCAGTTTAAGTCGGCTTTCTCTTGCTTTCACTACAGTCAGGAGGAGATAAAGGGCTCGGACTGCCTAGATCAGTTCCGGGCAATGCAAGAATGCATGCAGAAATACCCCGAATTATATCCACAGGAGGATGATGAGGATGAACTGGAGAAAGAGAAGCAGAATAAAGACGAAGAGTCTTCCGTCACACAGTCCTCCGATACCAAAGAAGAGAGTTCCAGCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCCGCTGATATCCCCTATAGTGAGTCGTAATACATGGGCCTAACCTGGTTTAAAAAAAAAAAAAAAAAAAAAAGTATAAAAATCATATAATGTTTCCAGCCGTCAAGGAGACAAAGGGGGAGAAAATCCCCCTCCCCTCTCGCGCCGGGAGGAGAGAAAAAAAAAAAAAAGAGAAAGAAAAAGAAAAACCCCCCCCCCGGGCGAACCACGCGTGGGCGGGGGAAGAAAGAAAAGAGCCCGCCCCCCCCCCCCCCCACCCGCGCGCCCCACCCCCCCCGGGCGCCGGCGGGGGGGGGGGGGGAGGGAGTATGAGATAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTACTGCAGGCAGGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ839861
dbEST ID: 79657563
Trimmed Sequence: GCTGGAACTCTCTTCTTTGGTATCGGAGGACTGTGTGACGGAAGACTCTTCGTCTTTATTCTGCTTCTCTTTCTCCAGTTCATCCTCATCATCCTCCTGTGGATATAATTCGGGGTATTTCTGCATGCATTCTTGCATTGCCCGGAACTGATCTAGGCAGTCCGAGCCCTTTATCTCCTCCTGACTGTAGTGAAAGCAAGAGAAAGCCGACTTAAACTGCTCCCCACAAGGACCACTGGCCATGCCTCCNAGGCACGGGCAGTTCCAATTGATGTCTCCATTTGGCAAGATCAGCCCTTGTTCCTCAAAAGGGTCATTTGGATCATCTGCAATCAGCTCTGCACTACTTGGAGTTTCATGGTCCTCCTTGGTTACAAAAATGATTTTGTCCTTTCCTTCCTGCCTGCAGTAGGACATGG
Full Trace Sequence: AAACTGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGGAACTCTCTTCTTTGGTATCGGAGGACTGTGTGACGGAAGACTCTTCGTCTTTATTCTGCTTCTCTTTCTCCAGTTCATCCTCATCATCCTCCTGTGGATATAATTCGGGGTATTTCTGCATGCATTCTTGCATTGCCCGGAACTGATCTAGGCAGTCCGAGCCCTTTATCTCCTCCTGACTGTAGTGAAAGCAAGAGAAAGCCGACTTAAACTGCTCCCCACAAGGACCACTGGCCATGCCTCCNAGGCACGGGCAGTTCCAATTGATGTCTCCATTTGGCAAGATCAGCCCTTGTTCCTCAAAAGGGTCATTTGGATCATCTGCAATCAGCTCTGCACTACTTGGAGTTTCATGGTCCTCCTTGGTTACAAAAATGATTTTGTCCTTTCCTTCCTGCCTGCAGTAGGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAATACAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTTATTGGGGGTCAAAAAAAAAAGAAAAAAACAACATTTAACATCTACATATGGCTGGTGGATGGGCGGCCGGGGAGAAAATCACCCAATCCCCCCCCCCGAAAAGGGGGGGGAGGGATAAAAATAAGGGGAGGGGGGAAGGGGCCCCACCCCGAGGAAAAACACCCGCCGGCGGGTTGGAAAAAAGTGAAAAAAAAAACCCGCCCCCCCCCCGCACCGGGAGGCACACACACCCCCACAACCGGGAGGGGGGGGGGGGAGGGGGGGGGGGGAGGGNANGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGGAACTCTCTTCTTTG