ORFeome > chmp1b ORF1 – XORFeome v1.0

chmp1b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: chmp1b
Gene ID: 5822145
Gene Page ID: 5822035
ORF Xenbase ID: 17269407

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC053765
Original XGC clone length: 600

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ839210
dbEST ID: 79656912
Trimmed Sequence: ATGTCTAGCATGGAGAAGCATCTGTTCAACCTGAAATTTGCTGCTAAAGAATTGAATCGAAATGCCAAAAAATGTGAAAAAGAAGAAAAAACTGAGAAAGCTAAAATTAAAAAGGCCATTCAGAAGGGCAATACCGAGATTGCAAGGATACATGCAGAGAATGCAATACGACAAAAAAATCAAGGTATTAATTTCTTACGGATGAGCGCTAGGGTGGATGCTGTGGCCGCAAGGGTTCAGACTGCAGTGACAATGGGCAAGGTAACAAAGTCTATGGCAGGAGTGGTGAAATCTATGGATGCTACCCTGAAGAGTATGAACTTAGAAAAGATCTCCGCTTTAATGGACAAATTTGAACACCAATTTGAGACGCTAGATGTGCAGACACAGCAAATGGAAGATACAATGAGTAACACAACCACATTAACCACCCCACAGAATCAAGTGGATAACTTGTTACACGAGATGGCAGATGAAGCTGGTCTTGACTTAAGCATGGAATTGCCCCAAGGCCAGACTGGATCTGTTGGTACCAGTGTAGCATCCACAGAACAGGATGAGCTATCGCANAGACTGGCCCGCCTGCGTGATCAAGTGTT
Full Trace Sequence: TCGAGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTAGCATGGAGAAGCATCTGTTCAACCTGAAATTTGCTGCTAAAGAATTGAATCGAAATGCCAAAAAATGTGAAAAAGAAGAAAAAACTGAGAAAGCTAAAATTAAAAAGGCCATTCAGAAGGGCAATACCGAGATTGCAAGGATACATGCAGAGAATGCAATACGACAAAAAAATCAAGGTATTAATTTCTTACGGATGAGCGCTAGGGTGGATGCTGTGGCCGCAAGGGTTCAGACTGCAGTGACAATGGGCAAGGTAACAAAGTCTATGGCAGGAGTGGTGAAATCTATGGATGCTACCCTGAAGAGTATGAACTTAGAAAAGATCTCCGCTTTAATGGACAAATTTGAACACCAATTTGAGACGCTAGATGTGCAGACACAGCAAATGGAAGATACAATGAGTAACACAACCACATTAACCACCCCACAGAATCAAGTGGATAACTTGTTACACGAGATGGCAGATGAAGCTGGTCTTGACTTAAGCATGGAATTGCCCCAAGGCCAGACTGGATCTGTTGGTACCAGTGTAGCATCCACAGAACAGGATGAGCTATCGCANAGACTGGCCCGCCTGCGTGATCAAGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATAACATGGGTCATAAACTGTTTTCCGGACAACTCTGGCCGGTCAAAAAAAACCACACCAAAAATTTAAAAAAAAANNNNAGAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTAGCATGGAGAAGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ839209
dbEST ID: 79656911
Trimmed Sequence: CACTTGATCACGCAGGCGGGCCAGTCTTTGCGATAGCTCATCCTGTTCTGTGGATGCTACACTGGTACCAACAGATCCAGTCTGGCCTTGGGGCAATTCCATGCTTAAGTCAAGACCAGCTTCATCTGCCATCTCGTGTAACAAGTTATCCACTTGATTCTGTGGGGTGGTTAATGTGGTTGTGTTACTCATTGTATCTTCCATTTGCTGTGTCTGCACATCTAGCGTCTCAAATTGGTGTTCAAATTTGTCCATTAAAGCGGAGATCTTTTCTAAGTTCATACTCTTCAGGGTAGCATCCATAGATTTCACCACTCCTGCCATAGACTTTGTTACCTTGCCCATTGTCACTGCAGTCTGAACCCTTGCGGCCACAGCATCCACCCTANCGCTCATCCGTAAGAAATTAATACCTTGATTTTTTTGTCGTATTGCATTCTCTGCATGTATCCTTGCAATCTCGGTATTGCCCTTCTGAATGGCCTTTTTAATTTTAGCTTTCTCAATTTTTTCTTCTTTTTCACATTTTTTGGCATTTCGATTCCATTCTTTTGCAACAAATTTCAGGTTGAACAGATGCTTTCTCCTGCCTAGAATGG
Full Trace Sequence: CGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTTGATCACGCAGGCGGGCCAGTCTTTGCGATAGCTCATCCTGTTCTGTGGATGCTACACTGGTACCAACAGATCCAGTCTGGCCTTGGGGCAATTCCATGCTTAAGTCAAGACCAGCTTCATCTGCCATCTCGTGTAACAAGTTATCCACTTGATTCTGTGGGGTGGTTAATGTGGTTGTGTTACTCATTGTATCTTCCATTTGCTGTGTCTGCACATCTAGCGTCTCAAATTGGTGTTCAAATTTGTCCATTAAAGCGGAGATCTTTTCTAAGTTCATACTCTTCAGGGTAGCATCCATAGATTTCACCACTCCTGCCATAGACTTTGTTACCTTGCCCATTGTCACTGCAGTCTGAACCCTTGCGGCCACAGCATCCACCCTANCGCTCATCCGTAAGAAATTAATACCTTGATTTTTTTGTCGTATTGCATTCTCTGCATGTATCCTTGCAATCTCGGTATTGCCCTTCTGAATGGCCTTTTTAATTTTAGCTTTCTCAATTTTTTCTTCTTTTTCACATTTTTTGGCATTTCGATTCCATTCTTTTGCAACAAATTTCAGGTTGAACAGATGCTTTCTCCTGCCTAGAATGGTGCCCACTTTTTTGTACAAGGTTGGCATTATAAAAAAAGCATTTGCTCACCATTTTGTTGCCAACAAAAAGGGTCACTATCAAGTCCAAATAAAATTAATTAATTAAGAAGCCCAAAACGTAGAGAGGGGCCCGTCCGTTCCAAGGGCGCTCCGGGGAACCAGGGGGCGGGTTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTTGATCACGCAGGCGG