ORFeome > chmp5 ORF1 – XORFeome v1.0

chmp5 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chmp5
Gene ID: 6253789
Gene Page ID: 5962692
ORF Xenbase ID: 17269449

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC041499
Original XGC clone length: 534

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11010
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ823807
dbEST ID: 79641509
Trimmed Sequence: ATGAAATACAAGGATCAAATGAAAAAAATGAGAGATGGGCCATCCAAGAACATGGTAAAACAGAAAGCCCTGCGAGTTCTCAAGCAGAAAAGAATGTATGAACAGCAGAGAGATAATCTAAACCAGCAATCTTTTAATATGGAACAAGCCAATTATACTATTCAGACACTAAAGGACACAAAAACAACGGTGGATGCAATGAAAGTAGGAGCTAAGGAAATGAAAAAGGCTTACAAGCAAGTCAAAATTGATCAGATTGAGGACTTGCAAGATCAGTTGGAGGATATGATGGAGAATGCCAATGAAATCCAGGAATCACTTAGTCGAAGCTATGGAACACCTGAAATTGATGAAGATGATCTTGAGGCTGAGCTGGATGCTCTAGGAGATGAACTTTTGTTAGATGACGACACCTCATATTTGGATGACGCTGTCTCTGCCCCAACTATCCCAGAAGGGGTTCCCAGTGACTCCAAAAATAAGGATGGAGTACTGGTTGATGAATTTGGATTGCCACAAATCCCTGCTACCTT
Full Trace Sequence: AATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATACAAGGATCAAATGAAAAAAATGAGAGATGGGCCATCCAAGAACATGGTAAAACAGAAAGCCCTGCGAGTTCTCAAGCAGAAAAGAATGTATGAACAGCAGAGAGATAATCTAAACCAGCAATCTTTTAATATGGAACAAGCCAATTATACTATTCAGACACTAAAGGACACAAAAACAACGGTGGATGCAATGAAAGTAGGAGCTAAGGAAATGAAAAAGGCTTACAAGCAAGTCAAAATTGATCAGATTGAGGACTTGCAAGATCAGTTGGAGGATATGATGGAGAATGCCAATGAAATCCAGGAATCACTTAGTCGAAGCTATGGAACACCTGAAATTGATGAAGATGATCTTGAGGCTGAGCTGGATGCTCTAGGAGATGAACTTTTGTTAGATGACGACACCTCATATTTGGATGACGCTGTCTCTGCCCCAACTATCCCAGAAGGGGTTCCCAGTGACTCCAAAAATAAGGATGGAGTACTGGTTGATGAATTTGGATTGCCACAAATCCCTGCTACCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCGGTAANTANTATAAATTTAGAAAAAAAAAAAAAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTNNNNNTTNNNTNTNTNTTTTTTNNTNTTNNNNNNNNNNNNNTTTTTTTTNNNTTTTTTTTTTTTTTTTNTTNTTTTTNAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATACAAGGATCAAATGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829117
dbEST ID: 79646819
Trimmed Sequence: GGTAGCAGGGATTTGTGGCAATCCAAATTCATCAACCAGTACTCCATCCTTATTTTTGGAGTCACTGGGAACCCCTTCTGGGATAGTTGGGGCAGAGACAGCGTCATCCAAATATGAGGTGTCGTCATCTAACAAAAGTTCATCTCCTAGAGCATCCAGCTCAGCCTCAAGATCATCTTCATCAATTTCAGGTGTTCCATAGCTTCGACTAAGTGATTCCTGGATTTCATTGGCATTCTCCATCATATCCTCCAACTGATCTTGCAAGTCCTCAATCTGATCAATTTTGACTTGCTTGTAAGCCTTTTTCATTTCCTTAGCTCCTACTTTCATTGCATCCACCGTTGTTTTTGTGTCCTTTAGTGTCTGAATAGTATAATTGGCTTGTTCCATATTAAAAGATTGCTGGTTTAGATTATCTCTCTGCTGTTCATACATTCTTTTCTGCTTGAGAACTCGCAGGGCTTTCTGTTTTACCATGTTCTTGGATGGCCCATCTCTCATTTTTTTCATTTGATCCTTGTATTTCATGG
Full Trace Sequence: CCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTAGCAGGGATTTGTGGCAATCCAAATTCATCAACCAGTACTCCATCCTTATTTTTGGAGTCACTGGGAACCCCTTCTGGGATAGTTGGGGCAGAGACAGCGTCATCCAAATATGAGGTGTCGTCATCTAACAAAAGTTCATCTCCTAGAGCATCCAGCTCAGCCTCAAGATCATCTTCATCAATTTCAGGTGTTCCATAGCTTCGACTAAGTGATTCCTGGATTTCATTGGCATTCTCCATCATATCCTCCAACTGATCTTGCAAGTCCTCAATCTGATCAATTTTGACTTGCTTGTAAGCCTTTTTCATTTCCTTAGCTCCTACTTTCATTGCATCCACCGTTGTTTTTGTGTCCTTTAGTGTCTGAATAGTATAATTGGCTTGTTCCATATTAAAAGATTGCTGGTTTAGATTATCTCTCTGCTGTTCATACATTCTTTTCTGCTTGAGAACTCGCAGGGCTTTCTGTTTTACCATGTTCTTGGATGGCCCATCTCTCATTTTTTTCATTTGATCCTTGTATTTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAATTCATTATTTGGGGCCCGAGCTTAGACTGGGCTCGTTAGGAGCCAAACGCGCGGCGGGGGGGGGGNNNNNGGGGGGGCCNNNCCCGCCCCCGNNNNCTTGGAGGGNNNNNGGNCCNNCNAAAANNNGGCGGGAAAGGAGGGGGGGGGGGGGACGGGGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTAGCAGGGATTTGTGG