ORFeome > chrd ORF1 – XORFeome v1.0

chrd ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chrd
Gene ID: 865395
Gene Page ID: 480637
ORF Xenbase ID: 17269515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC077767
Original XGC clone length: 2823

Human orthology & disease relationships

NCBI Entrez ID: 8646
Ensembl gene IDs: ENSG00000090539
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 112600,113100,158350,184460,185800,186500,186570,200700,201250,228900,261550,609441,610017,610069

Library Location

Plate ID: GDExl11037
Well Location: G04

Sequences - 5ʹ (forward) EST

Accession: JZ827178
dbEST ID: 79644880
Trimmed Sequence: ATGCAGTGTCCCCCCATCCTACTTGTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCATGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGCGTACTATGCTATTGTGAGCCGCAGCGAAGTCGTCGGGGAAAACCATCTGGTAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTGCTAACCCTATACTGCTCCCAGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCTGATGATGTCGCTGTGGAGGAGAGTCGTTCAGAATATGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCCAATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGGGATGACACTATCTGGGGGCATTTGGAAGTCCCCTAATCGGTCCACTCTACGTCTTTCTCCAAATGGGTCACAATTCTTTGTATCTCTGGGTGACAACAACACTTTTTCAAAACCCGGAAAATTT
Full Trace Sequence: GGCCCCAAATAATAGATTGTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAGTGTCCCCCCATCCTACTTGTGTGGACCCTGTGGATTATGGCTGTGGATTGCTCTCGCCCAAAGGTTTTCTTGCCCATTCAGCCTGAACAGGAGCCCCTCCAATCCAAGACTCCAGCAGGTTGTACATTTGGTGGGAAATTTTACTCCCTGGAGGATTCATGGCATCCAGATCTTGGGGAACCATTCGGAGTTATGCACTGCGTACTATGCTATTGTGAGCCGCAGCGAAGTCGTCGGGGAAAACCATCTGGTAAAGTCAGCTGCAAAAACATCAAACATGATTGCCCCTCACCCTCCTGTGCTAACCCTATACTGCTCCCAGGACATTGCTGCAAGACTTGTCCCAAAGCTCCTCCTCCTCCTATAAAGAAATCAGACTTTGTTTTTGACGGATTTGAGTATTTTCAAGAGAAGGATGATGATCTTTATAATGATCGCTCTTATCTGAGTTCTGATGATGTCGCTGTGGAGGAGAGTCGTTCAGAATATGTGGCACTACTAACAGCACCCAGCCATGTGTGGCCCCCAGTTACCAGTGGAGTAGCCAAGGCTAGATTCAACCTGCAGCGCTCCAATTTGCTCTTCTCAATCACTTATAAATGGATAGACAGACTTTCCAGAATCCGTTTCTCCGATCTTGACGGTTCTGTGCTGTTTGAACACCCAGTGCACAGAATGGGATCCCCACGGGATGACACTATCTGGGGGCATTTGGAAGTCCCCTAATCGGTCCACTCTACGTCTTTCTCCAAATGGGTCACAATTCTTTGTATCTCTGGGTGACAACAACACTTTTTCAAAACCCGGAAAATTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGTGTCCCCCCATCCTACTT

Sequences - 3ʹ (reverse) EST

Accession: JZ827177
dbEST ID: 79644879
Trimmed Sequence: AAAACTCCATGGAGTCCTTGTCTCGTCTGATTTCACTTTTTCATCTTCATCTTGATTGGCATCTTTGCACTTGGTGCAACATCTGTCCCGCTTTGAACCAGTACCACATGTAGTTCCTGTACACTCCTGTCTCCGACACTGTGTAATGCCCTCCGCACAAGTGCATGTAACACATTTCATCTCTCCAAAGGGTGGCACAGTTGGATGCCAACGCTCATGATTTGGGTACCAGTGACGCCCAAATCTGCATGATCCTGCTCCATCTGACTGCATACTGTCTGCCAGTTCCATAGGACTCCGCTCCTCTGGGCACTGCTTGCAGCAATCAGAAGGATTGGCACGGATTGGGTTGGTACAGGAAAGTTTTGGACAGGTCACCTTCTCACAGTGCACTTCTCCAGTGGAACCCTTGCAGGTGCAAATGGCACATTTAATTAGACCAAATGGAGGAACAAAAGGATGCCAACGTGTACCAGCTGCCTTCCATGAGCGATCTCCATCAAAAAAGCAGCCTTCACTTGTGCGAGCCCTCTCTGGTTTTTTCACCTCTCTCATTTCTTTTTTTTCTTCACACACAGGACAGCACTGATCTGGCAAATGGACAGGCTGGGAGCAGTTCAAAGGTGGGCACACAATAGGATCACAAATCACGGTACGCTTCTGACAACTGCACCCAGAACAATTTCCGTTCATAGTCTGGAAACCCATCGTGAACCAAGGGGCCCCTTTAATTGAACCTTCTAAAAAACCATG
Full Trace Sequence: GAAAACAGCTAATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAAACTCCATGGAGTCCTTGTCTCGTCTGATTTCACTTTTTCATCTTCATCTTGATTGGCATCTTTGCACTTGGTGCAACATCTGTCCCGCTTTGAACCAGTACCACATGTAGTTCCTGTACACTCCTGTCTCCGACACTGTGTAATGCCCTCCGCACAAGTGCATGTAACACATTTCATCTCTCCAAAGGGTGGCACAGTTGGATGCCAACGCTCATGATTTGGGTACCAGTGACGCCCAAATCTGCATGATCCTGCTCCATCTGACTGCATACTGTCTGCCAGTTCCATAGGACTCCGCTCCTCTGGGCACTGCTTGCAGCAATCAGAAGGATTGGCACGGATTGGGTTGGTACAGGAAAGTTTTGGACAGGTCACCTTCTCACAGTGCACTTCTCCAGTGGAACCCTTGCAGGTGCAAATGGCACATTTAATTAGACCAAATGGAGGAACAAAAGGATGCCAACGTGTACCAGCTGCCTTCCATGAGCGATCTCCATCAAAAAAGCAGCCTTCACTTGTGCGAGCCCTCTCTGGTTTTTTCACCTCTCTCATTTCTTTTTTTTCTTCACACACAGGACAGCACTGATCTGGCAAATGGACAGGCTGGGAGCAGTTCAAAGGTGGGCACACAATAGGATCACAAATCACGGTACGCTTCTGACAACTGCACCCAGAACAATTTCCGTTCATAGTCTGGAAACCCATCGTGAACCAAGGGGCCCCTTTAATTGAACCTTCTAAAAAACCATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAAACTCCATGGAGTCCTTG