ORFeome > chst11 ORF1 – XORFeome v1.0

chst11 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chst11
Gene ID: 6253415
Gene Page ID: 955997
ORF Xenbase ID: 17269551

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC056117
Original XGC clone length: 996

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ824701
dbEST ID: 79642403
Trimmed Sequence: ATGGCCCTGGCCACCTGCCTGGGATCCTTCATTTTGCTCATATTCTACTTCCAGAGCCATTTGGGTTCAGCTGAAGAGCAGTTCTTGGGTGGAAGATGGCATGGAAAGCCCAGAAGAAGTCCCTTACAATCCCTTTATGACAGCACGCAGTTGGAGCCCTCCTCTATCCAAGCAAAGCATCAGAGGCGCCGGGAGCTGCTGGCCAGCACCTGTAAGACTTACACAAGGAAGCGCCGAGTCCTGACATCTGATGATCTGAAACACCTTGTTGTGGATGACACCCATGGACTTCTGTACTGCTATGTACCAAAGGTAGCCTGTACCAATTGGAAGAGGGTCATGATGGTCCTCACTGGTCAGGGGAAGTATAAGGACCCGTCTCTCATCCCGGCAAACGAAGCTCACATTCCCTCAAACCTTCGCTTGCTCTCTGAGTTCAGCACCCCAGAAATCAATTACCGGCTAAGGAACTACCTCAAGTTTATTTTTGTGAGGGAGCCATTTGAGAGGCTGGTGTCCGCATACAGGAACAAGTTTACCCGCACGTATAACACAGCCTTTCACAAGCGATATGGGACCAAGATCATTGAACGTCATCGTAGGGATCCCTCTGTAGAGGCCCTGGAGNCACGGCATGATGTCACCTTTGAGGAAGTCTTGTACTACCTTTTGTGGACCGGTGACCCAAAGGGAGGAACCNTTTTTATGACACGTGGGAGAAGGTGCATTCTCNTTTGTCATCCGTGCATCANTCCATAATGATTGGTTGTAGGGAAAGTATGAAACCGCTGGGAGATGAAAGGCTTGATTATTTGGTTGCCCCCCTTTATTTTGGAAATCCGAAAAACTCCT
Full Trace Sequence: TATTTTAGAACTGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCTGGCCACCTGCCTGGGATCCTTCATTTTGCTCATATTCTACTTCCAGAGCCATTTGGGTTCAGCTGAAGAGCAGTTCTTGGGTGGAAGATGGCATGGAAAGCCCAGAAGAAGTCCCTTACAATCCCTTTATGACAGCACGCAGTTGGAGCCCTCCTCTATCCAAGCAAAGCATCAGAGGCGCCGGGAGCTGCTGGCCAGCACCTGTAAGACTTACACAAGGAAGCGCCGAGTCCTGACATCTGATGATCTGAAACACCTTGTTGTGGATGACACCCATGGACTTCTGTACTGCTATGTACCAAAGGTAGCCTGTACCAATTGGAAGAGGGTCATGATGGTCCTCACTGGTCAGGGGAAGTATAAGGACCCGTCTCTCATCCCGGCAAACGAAGCTCACATTCCCTCAAACCTTCGCTTGCTCTCTGAGTTCAGCACCCCAGAAATCAATTACCGGCTAAGGAACTACCTCAAGTTTATTTTTGTGAGGGAGCCATTTGAGAGGCTGGTGTCCGCATACAGGAACAAGTTTACCCGCACGTATAACACAGCCTTTCACAAGCGATATGGGACCAAGATCATTGAACGTCATCGTAGGGATCCCTCTGTAGAGGCCCTGGAGNCACGGCATGATGTCACCTTTGAGGAAGTCTTGTACTACCTTTTGTGGACCGGTGACCCAAAGGGAGGAACCNTTTTTATGACACGTGGGAGAAGGTGCATTCTCNTTTGTCATCCGTGCATCANTCCATAATGATTGGTTGTAGGGAAAGTATGAAACCGCTGGGAGATGAAAGGCTTGATTATTTGGTTGCCCCCCTTTATTTTGGAAATCCGAAAAACTCCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCTGGCCACCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ830053
dbEST ID: 79647755
Trimmed Sequence: GTGTATCTTTAGGAAATGTGGGACAGTGTAATTAAAGAGCAGAAAGTCCATCTTGTACAAGTTGAAGAGTCTGCGCTGGTAGAAGAGCGGCACAGTCTTGAAGAACTCGGCAGCCATCCCATCTGTGGTCCGTGTCGTTTTGGAAGATGATGGAAATTTGAAGGAGTCTCCGACTCCAATAAGCTGCAACAAATACTCAGCATCATCTTCCAGCGTTTCATACTTTCCTACAACATCATAATGGATGATGCACGGATGACAAAGAGAATGCACCCTCTCCCAGTGTTCATTAAAAGGTTCCTCCCTTTGGGTCACCGGGTCCACAAGGTAGTACAAGAACTCCTCAAAGGTGACATCATTGCCGTGCTCCAGGGCCTCTACAGAGGGATCCCTACGATGACGTTCAATGATCTTGGTCCCATATCGCTTGTGAAAGGCTGTGTTATACGTGCGGGTAAACTTGTTCCTGTATGCGGACACCAGCCTCTCAAATGGCTCCCTCACAAAAATAAACTTGAGGTAGTTCCTTAGCCGGTAATTGATTTCTGGGGTGCTGAACTCAGAGAGCAAGCGAAGGTTTGAGGGAATGTGAGCTTCGTTTGCCGGGATGAGAGACGGGTCCTTATACTTCCCCTGACCAGTGAGGACCATCATGACCCTCTTTCCATTGGTACAGGCTACCTTGGGTAATAGCCAGTACAGAAATTCCATGGGTGTCAACCCCCAAACAAGTTGTTTTCAAAATCATCCAAATGTCCGGGAC
Full Trace Sequence: GCGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTATCTTTAGGAAATGTGGGACAGTGTAATTAAAGAGCAGAAAGTCCATCTTGTACAAGTTGAAGAGTCTGCGCTGGTAGAAGAGCGGCACAGTCTTGAAGAACTCGGCAGCCATCCCATCTGTGGTCCGTGTCGTTTTGGAAGATGATGGAAATTTGAAGGAGTCTCCGACTCCAATAAGCTGCAACAAATACTCAGCATCATCTTCCAGCGTTTCATACTTTCCTACAACATCATAATGGATGATGCACGGATGACAAAGAGAATGCACCCTCTCCCAGTGTTCATTAAAAGGTTCCTCCCTTTGGGTCACCGGGTCCACAAGGTAGTACAAGAACTCCTCAAAGGTGACATCATTGCCGTGCTCCAGGGCCTCTACAGAGGGATCCCTACGATGACGTTCAATGATCTTGGTCCCATATCGCTTGTGAAAGGCTGTGTTATACGTGCGGGTAAACTTGTTCCTGTATGCGGACACCAGCCTCTCAAATGGCTCCCTCACAAAAATAAACTTGAGGTAGTTCCTTAGCCGGTAATTGATTTCTGGGGTGCTGAACTCAGAGAGCAAGCGAAGGTTTGAGGGAATGTGAGCTTCGTTTGCCGGGATGAGAGACGGGTCCTTATACTTCCCCTGACCAGTGAGGACCATCATGACCCTCTTTCCATTGGTACAGGCTACCTTGGGTAATAGCCAGTACAGAAATTCCATGGGTGTCAACCCCCAAACAAGTTGTTTTCAAAATCATCCAAATGTCCGGGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTATCTTTAGGAAATGTGGG