ORFeome > chtf8 ORF1 – XORFeome v1.0

chtf8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chtf8
Gene ID: 6256159
Gene Page ID: 5729734
ORF Xenbase ID: 17269587

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129538
Original XGC clone length: 366

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ837898
dbEST ID: 79655600
Trimmed Sequence: ATGGTGCAGATCCTGGTGTCCCGGGATCCGCAAGGACAACCAGAAGACTGGCTTCTGATGGAGCTACAGGGGCAGATAGAAGATCGGAAACAGGATGGTCTCACTGGCAAGGTGATGGGAGATCTGCATTATACCAAAGAGGGTGTCCCACTGCTGATTGTTGGACATCACATCCTTTATGGGAAGGTGGTGCGTCTAGACAAGCCGTTTGCAGTTTTGGTAAAGAGCAGCAGCTCCATGCAGGAGGCAGATCATACTATGACTGAGGCAAGCACTAGGTATCAGGTGACCGCACTGATTAAGAAGAAAATCATCTTCAAAACAAGGCCCAAGCCCATCATCACTAATGTCCCGAAGAAGGTGTT
Full Trace Sequence: GGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGATCCTGGTGTCCCGGGATCCGCAAGGACAACCAGAAGACTGGCTTCTGATGGAGCTACAGGGGCAGATAGAAGATCGGAAACAGGATGGTCTCACTGGCAAGGTGATGGGAGATCTGCATTATACCAAAGAGGGTGTCCCACTGCTGATTGTTGGACATCACATCCTTTATGGGAAGGTGGTGCGTCTAGACAAGCCGTTTGCAGTTTTGGTAAAGAGCAGCAGCTCCATGCAGGAGGCAGATCATACTATGACTGAGGCAAGCACTAGGTATCAGGTGACCGCACTGATTAAGAAGAAAATCATCTTCAAAACAAGGCCCAAGCCCATCATCACTAATGTCCCGAAGAAGGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCNNCAAAAAAAAAAAACAAAAAATCTCTTATGTTACATGGGAAACGGCGGGGGAGAAAAAACCAAACCCCTCTCCAAAAAAGGGCGGTGGTCTAATTTGTTTTTATGGGGGAAGCCCCACCAAAGGGAAAAAACCCGTGGGGCCGTATTTTTGTTTTGGAAAAACGTGGGGGGTGGGGGGGGGGGCCCAAACATTGGGAAAAAAGGGGGGGGGAGGCCGCCCCCGGGGGGTGTTGATTAGTTTTTTTTTTTTTTTTTTTTTTGTTTAATATTTTATTTAACTGCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGATCCTGGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837897
dbEST ID: 79655599
Trimmed Sequence: CACCTTCTTCGGGACATTAGTGATGATGGGCTTGGGCCTTGTTTTGAAGATGATTTTCTTCTTAATCAGTGCGGTCACCTGATACCTAGTGCTTGCCTCAGTCATAGTATGATCTGCCTCCTGCATGGAGCTGCTGCTCTTTACCAAAACTGCAAACGGCTTGTCTAGACGCACCACCTTCCCATAAAGGATGTGATGTCCAACAATCAGCAGTGGGACACCCTCTTTGGTATAATGCAGATCTCCCATCACCTTGCCAGTGAGACCATCCTGTTTCCGATCTTCTATCTGCCCCTGTAGCTCCGTCAAAAGCCAGTCTTCTGGTTGTCCTTGCGGATCCCGGGACACCAGGATCTGCACCATGG
Full Trace Sequence: GGGCCAGGGAACAGCTTATGACCATGTAATACGACTCACTATANGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACCTTCTTCGGGACATTAGTGATGATGGGCTTGGGCCTTGTTTTGAAGATGATTTTCTTCTTAATCAGTGCGGTCACCTGATACCTAGTGCTTGCCTCAGTCATAGTATGATCTGCCTCCTGCATGGAGCTGCTGCTCTTTACCAAAACTGCAAACGGCTTGTCTAGACGCACCACCTTCCCATAAAGGATGTGATGTCCAACAATCAGCAGTGGGACACCCTCTTTGGTATAATGCAGATCTCCCATCACCTTGCCAGTGAGACCATCCTGTTTCCGATCTTCTATCTGCCCCTGTAGCTCCGTCAAAAGCCAGTCTTCTGGTTGTCCTTGCGGATCCCGGGACACCAGGATCTGCACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGAGCTTAATACTAAGAGACATTCTACAACATCGTGACTGGGCTTCTCGAAACGGCCGGGGACAAATAAGATAAACGAAAAAGCAACCAACCGTGCCGTGGGGTCCATCGTTTGTAGGCGGAGAAAGGTCAAACACAAAAGGACAAAGCGCTGTGGGCTGCATTGGTCGGTTTGCAAAAACGTGTGGGGGGGGCGCGGGGGCCAGAACCCTGGAAAAAACAAACCGGTGGGTGGGGGGAAGGGCGTGTTGCGGGGTTTGCATGCCGGTTTTGATGGGGTTCCNGCAAAACTTGCGGAAGGCACGCGCCAGGCGCGTCACCCCGGGGGGCGGATTTAGATGGGTGGTAGCAAACAGAATGTTANAGNAGAGGGCNNGGNCTCGCGAGGGGAAAGGAGATTGAGAGGGGGGGAGGGGGGCGTCCAANGAGTCAAGCGNAATATNGANNAGGGGGGGAGAAGAAGGGGGCCGNNGCAAACGACCNAGGCNCGGGGGNNNGGNGNGNGGNGGGAGAAAGNGGGGGGGAGAGGGGGAGGGGATNGAGGNNNNGTCGGATTTATTGGNNTNGNGGNGTGNAGANNNGGGNGAGAGAGTAGGNNGANAAGGNGGANNGGANGNNNTATNNGNGANGANAGAGNGGGGAGGNAGGAGGGGGAGGNGCAGGGANGGGGCAGGCAGGAGAAGGGGAGAGCGGGGGAGGNGGAGAAGGAAGGGAAGAGGGAGGGANNGGNNNGGGAAGAGAAGAAAGAAAGNGGAACANNGGGGGGGGNNGGGGAAGGAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTTCTTCGGGACATT