ORFeome > chtop ORF2 – XORFeome v1.0

chtop ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chtop
Gene ID: 997796
Gene Page ID: 997790
ORF Xenbase ID: 17269599

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106624
Original XGC clone length: 744

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: D04

Sequences - 5ʹ (forward) EST

Accession: JZ837681
dbEST ID: 79655383
Trimmed Sequence: ATGGCCGCCCCATCCGCGTCTAAAGTTGTGCTAAAGAGTACCACAAAGTTGTCGCTGAATGAGCGCTTTACTAACATGCTGAAGAATAAACAGCCGATGCCGGTGAATATCCGCGCCAGCTTGCAGCAACAGCAGCACACGGCCAGTGCTAAGAACAGAAGACTTGCTCAGCAGATGGAGAACAGGCCGTCTGTGCAGGCGGCCCTCAAGCTCAAACAGAGTCTAAAGCAGCGTCTCGGTAAGAGCAATATCCAGGCCCGGCTGGGAAGGCCAATGGGAGGTCTTGTACGGGGAGCCATAGGAATGAGAGGAGCAGGAATGGGACTACGAGGAATACAGAGAGGGGTGATGCGTGGCGGTCGTGGGGGAAGAGGAATGGCCAGGGGATCCATGGCTATGAGGGGGCAGAACCTCAGAGGACGAGGTGGAGTATCCAGAATGGGACTGAGGAGAGGGATGAGGGGCCGAGGGGGTCCCGGCAGGGGAATGATGAAAGGGGCCATGGGCCGAGGCGGAATGGGTGGAAGAGGAGGAATGGGTGCAACAGGTCGTGTGGGAATGACCAGAAGAAAAGGCTTTGGACGAAGTAGAGGACGAAGGACAAGAAAGGGTTGTAACCCCCCAGTTAATACAAGGAACAGGGGGAATAGCGACTTTGTGCCTGAATGGTTAATACAAGGGGGGCCCCTGGATGCCTAACTGGAATGCCTAGTTGCCACAAGCAAAACCCGAAGTCAGACGGGTGGGGCTGTGGGTTTTT
Full Trace Sequence: GGAGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGCCCCATCCGCGTCTAAAGTTGTGCTAAAGAGTACCACAAAGTTGTCGCTGAATGAGCGCTTTACTAACATGCTGAAGAATAAACAGCCGATGCCGGTGAATATCCGCGCCAGCTTGCAGCAACAGCAGCACACGGCCAGTGCTAAGAACAGAAGACTTGCTCAGCAGATGGAGAACAGGCCGTCTGTGCAGGCGGCCCTCAAGCTCAAACAGAGTCTAAAGCAGCGTCTCGGTAAGAGCAATATCCAGGCCCGGCTGGGAAGGCCAATGGGAGGTCTTGTACGGGGAGCCATAGGAATGAGAGGAGCAGGAATGGGACTACGAGGAATACAGAGAGGGGTGATGCGTGGCGGTCGTGGGGGAAGAGGAATGGCCAGGGGATCCATGGCTATGAGGGGGCAGAACCTCAGAGGACGAGGTGGAGTATCCAGAATGGGACTGAGGAGAGGGATGAGGGGCCGAGGGGGTCCCGGCAGGGGAATGATGAAAGGGGCCATGGGCCGAGGCGGAATGGGTGGAAGAGGAGGAATGGGTGCAACAGGTCGTGTGGGAATGACCAGAAGAAAAGGCTTTGGACGAAGTAGAGGACGAAGGACAAGAAAGGGTTGTAACCCCCCAGTTAATACAAGGAACAGGGGGAATAGCGACTTTGTGCCTGAATGGTTAATACAAGGGGGGCCCCTGGATGCCTAACTGGAATGCCTAGTTGCCACAAGCAAAACCCGAAGTCAGACGGGTGGGGCTGTGGGTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCCCCATCCGC

Sequences - 3ʹ (reverse) EST

Accession: JZ837680
dbEST ID: 79655382
Trimmed Sequence: GTCGTTGGACTCTGGGTCTGCCTGTGCCATGTAGGCATCCAGCTCGGCATCCAGGTGCCCCCTCGTTTTAGACATATAGGCATCAAGTTGGTTATCCAGCTGCTCCTTTGTTATAACTGGGCGGGTCACACCCCTTCCTCTCCCTCGTCCTCTACCTCGTCCAAAGCCTCTTCCTCTGGTCATTCCCCCACGACCTCTTGCACCCATTCCTCCTCTTCCACCCATTCCGCCTCGGCCCATGGCCCCTCTCATCATTCCCCTGCCGGGACCCCCTCGGCCCCTCATCCCTCTCCTCAGTCCCATTCTGGATACTCCACCTCGTCCTCTGAGGTTCTGCCCCCTCATAGCCTTGGATCCCCTGGCCATTCCTCTTCCCCCACAACCGCCACGCATCACCCCTCTCTGTATTCCTCGTAGTCCCATTCCTGCTCCTCTCATTCCCATGGCTCCCCGTACAAAACCTCCCATTGGCCTTCCCAGCCGGGCCTGGAGATTGCTCTTACCGAGACGCTCCTTTAGACTCTGTTTGAGCTTGAGGGCCGCCTGCACAGACGGCCTGTTCTCCCTCTGCTGAGCAAGTCTTCTGTTCTTACCACTGGCCGTGTGCTGCTGTTGGCTGCAACTGGGCCGGATATTCACCGGCATCGTCTGTTTATTCTTCACCATGTGAGTAAGGCGCTGCTTCCACCAAAACTTTGTGGTAGTCTTTTGACGCAACTTAAAACGCGAATGGGGGGGCGAGGGGGCCGAGCTTGTTTGGACAAAATTGGCATTATAAAAAAACATTGCTCGGTCATTTGTTGCAGGGAAGAGGTCAGTAGAACTCAAAAAAAAAAAAAAAAAAGAAGCGAAAGATAAAAATAGCCTGTGTTTTCTACGCTCCGGGACGAAAAAAGAAAAAAAAAAAAAACCGNNNGGGGGGTTNTTTTTTGATCGTGTGAATAAGAGGGAAGAACACACACAACGGAAGAAAAAAACGGTGGAAGAGAAAAAAGAAAAGAGGGAAGAGAAAAAGAGCGGCACAGANNNNNNAGGAGAAAAGGANGAAAAAGAGAGNGGGGGGAGAGCNGAGGGGATGGGGCGTTGNAGGGAGAGGGAAAAAGAAAAAAAAAAAAAAAAGAAAGAAAAAAAAAAAAAAAAAAAAGAAAGAGAGAGAAAAANGAAAAAAAGAGAAAGAGAGAGAAGAAGGANGAGNGGGGGGGGNNANNGCNNGGNGGAGGGGAAGANNGNA
Full Trace Sequence: CGGACAGGTAACAGCCATTGAACATGGTAAAACGACTCACTATACGGGGAAACCAGCCTGGATGGCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGTTGGACTCTGGGTCTGCCTGTGCCATGTAGGCATCCAGCTCGGCATCCAGGTGCCCCCTCGTTTTAGACATATAGGCATCAAGTTGGTTATCCAGCTGCTCCTTTGTTATAACTGGGCGGGTCACACCCCTTCCTCTCCCTCGTCCTCTACCTCGTCCAAAGCCTCTTCCTCTGGTCATTCCCCCACGACCTCTTGCACCCATTCCTCCTCTTCCACCCATTCCGCCTCGGCCCATGGCCCCTCTCATCATTCCCCTGCCGGGACCCCCTCGGCCCCTCATCCCTCTCCTCAGTCCCATTCTGGATACTCCACCTCGTCCTCTGAGGTTCTGCCCCCTCATAGCCTTGGATCCCCTGGCCATTCCTCTTCCCCCACAACCGCCACGCATCACCCCTCTCTGTATTCCTCGTAGTCCCATTCCTGCTCCTCTCATTCCCATGGCTCCCCGTACAAAACCTCCCATTGGCCTTCCCAGCCGGGCCTGGAGATTGCTCTTACCGAGACGCTCCTTTAGACTCTGTTTGAGCTTGAGGGCCGCCTGCACAGACGGCCTGTTCTCCCTCTGCTGAGCAAGTCTTCTGTTCTTACCACTGGCCGTGTGCTGCTGTTGGCTGCAACTGGGCCGGATATTCACCGGCATCGTCTGTTTATTCTTCACCATGTGAGTAAGGCGCTGCTTCCACCAAAACTTTGTGGTAGTCTTTTGACGCAACTTAAAACGCGAATGGGGGGGCGAGGGGGCCGAGCTTGTTTGGACAAAATTGGCATTATAAAAAAACATTGCTCGGTCATTTGTTGCAGGGAAGAGGTCAGTAGAACTCAAAAAAAAAAAAAAAAAAGAAGCGAAAGATAAAAATAGCCTGTGTTTTCTACGCTCCGGGACGAAAAAAGAAAAAAAAAAAAAACCGNNNGGGGGGTTNTTTTTTGATCGTGTGAATAAGAGGGAAGAACACACACAACGGAAGAAAAAAACGGTGGAAGAGAAAAAAGAAAAGAGGGAAGAGAAAAAGAGCGGCACAGANNNNNNAGGAGAAAAGGANGAAAAAGAGAGNGGGGGGAGAGCNGAGGGGATGGGGCGTTGNAGGGAGAGGGAAAAAGAAAAAAAAAAAAAAAAGAAAGAAAAAAAAAAAAAAAAAAAAGAAAGAGAGAGAAAAANGAAAAAAAGAGAAAGAGAGAGAAGAAGGANGAGNGGGGGGGGNNANNGCNNGGNGGAGGGGAAGANNGNA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGTTGGACTCTGGGTCT