ORFeome > churc1 ORF1 – XORFeome v1.0

churc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: churc1
Gene ID: 6252415
Gene Page ID: 853239
ORF Xenbase ID: 17269605

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123207
Original XGC clone length: 339

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: B08

Sequences - 5ʹ (forward) EST

Accession: JZ838302
dbEST ID: 79656004
Trimmed Sequence: ATGTGCGGAGGCTGCGTCCAGCAGGAGTACCCGGACCGGGGGAGCACATGCTTGGAGACAGGTTCATACTTGTTAAACTATGTGAGCTGCGTTCAGTGCAATAAGAGAGACTTTGTTCTCATAGTGAATAAAACAGCAGCAGAAGAGGATGGGGAAGAGATTATCACTTATGACCATATGTGCAAAAACTGTCACCATGTGATTGCAAAACATGAATATACCTTTAGTGTGGTTGATGACTACCAGGAATATACCATGCTGTGCATGCTGTGCGGAAGAGCTGAGGACTCTGTCAGTGTTCTACCCGATGACCCACGACAGATGGCTCCACTTTTCTT
Full Trace Sequence: CTCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGNACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGCGGAGGCTGCGTCCAGCAGGAGTACCCGGACCGGGGGAGCACATGCTTGGAGACAGGTTCATACTTGTTAAACTATGTGAGCTGCGTTCAGTGCAATAAGAGAGACTTTGTTCTCATAGTGAATAAAACAGCAGCAGAAGAGGATGGGGAAGAGATTATCACTTATGACCATATGTGCAAAAACTGTCACCATGTGATTGCAAAACATGAATATACCTTTAGTGTGGTTGATGACTACCAGGAATATACCATGCTGTGCATGCTGTGCGGAAGAGCTGAGGACTCTGTCAGTGTTCTACCCGATGACCCACGACAGATGGCTCCACTTTTCTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTAAAAAAAAAACAAAAAAAAAAAATAAAAAATAGTGCCTCCGCCCCCGGGGAAAAAAAAAAAGGAAAATACTTAATACAAACTGTTGTGTTTTGGTTCAGAGTGGTGAGAGAGAAAAAAAGCACCCAAACCCAACAAAAAACCCGGCCGGGGGGGGGGTGGGTTTAAACAACAGGAAGCAACGGGCGCCCCCTCCCCCCACCCCACGAGAAACAAACGCGGGGGGGGGGGGTGGGGAGGGGTTGTTTTTGCGTTTATTTTTTTTTTTTTTTCTCTCTTCCACTAGAGGTGGGCACAAAAAAAACCCACAAAACAACCAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGGAGGCTGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838301
dbEST ID: 79656003
Trimmed Sequence: GAAAAGTGGAGCCATCTGTCGTGGGTCATCGGGTAGAACACTGACAGAGTCCTCAGCTCTTCCGCACAGCATGCACAGCATGGTATATTCCTGGTAGTCATCAACCACACTAAAGGTATATTCATGTTTTGCAATCACATGGTGACAGTTTTTGCACATATGGTCATAAGTGATAATCTCTTCCCCATCCTCTTCTGCTGCTGTTTTATTCACTATGAGAACAAAGTCTCTCTTATTGCACTGAACGCAGCTCACATAGTTTAACAAGTATGAACCTGTCTCCAAGCATGTGCTCCCCCGGTCCGGGTACTCCTGCTGGACGCAGCCTCCGCACATGG
Full Trace Sequence: GAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAAAGTGGAGCCATCTGTCGTGGGTCATCGGGTAGAACACTGACAGAGTCCTCAGCTCTTCCGCACAGCATGCACAGCATGGTATATTCCTGGTAGTCATCAACCACACTAAAGGTATATTCATGTTTTGCAATCACATGGTGACAGTTTTTGCACATATGGTCATAAGTGATAATCTCTTCCCCATCCTCTTCTGCTGCTGTTTTATTCACTATGAGAACAAAGTCTCTCTTATTGCACTGAACGCAGCTCACATAGTTTAACAAGTATGAACCTGTCTCCAAGCATGTGCTCCCCCGGTCCGGGTACTCCTGCTGGACGCAGCCTCCGCACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCGGCCCGACCTTAATACTGNCCAAAAAAAAAAAACAAAAAAGAACTGAAAAAAGAGGCTCCCACACCCGCCGCGAAAAAAAAAGAAACAACTATAACTAAACTAACGCGCGTGTGGGGAGAGCTGGGGGGGGGGAAAAAAAGACAAAAAAGCGCAAAAAAAAAAGGGTGGGGTTTTTGNTTTTAAAAGGGGGGGGAGGGGGGAAACCGNCCCCCGAAAAAAGAAAANNAGACCCGGGGGGGGGGGAGGAAAGGGGGGGGGGGGNNNNGGGNNNNNGGGNGNNNGANNNNNNNNNNGNNNNNNNNNNNNNNNNNNNGGGGNGGNNGNNNNNGGNGAN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAAGTGGAGCCATCTGT