ORFeome > ciapin1 ORF1 – XORFeome v1.0

ciapin1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ciapin1
Gene ID: 998249
Gene Page ID: 998243
ORF Xenbase ID: 17269611

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097801
Original XGC clone length: 936

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ838403
dbEST ID: 79656105
Trimmed Sequence: ATGGATGATCTAGCAAACTTAGTGTTTCCTGGTCAGCAAGTTGCTGTGACGTGGGATGGCAGTTCCTCCACAGAAGCTCTGAAGGAGTTTGTATCAAAGTTGCAGGAGGTAGTGGCACTACGGGGCAAGGTCTCTGTTGAGAACATAGAGCGACTGCTGCTTTCTGCTCACGCTGATTCAAGTTTTGATGCCATTCTGCTTGGTATGGTCCAAGGAACTCAGTGCATACACAGCTCTGAAGTACTTGCAGAGGTTGCCCGAATCTTGAAGCCTGGTGGGGCACTGATCATACAAGAGCCAGTGGCAGCCGGAGCTGGGGCTCAGCTCAGGACTCCAGAACACCTCTCCTCTGTGCTTAAACTATCTGGATTAACTGAAGTTACACAGCTGCTGCAAGAGCCCCTAAACCCTGAACAGAAGCAAGGAGTTGTTGAGCTGCTAGGATACAATGGGAATGATGTTAGCACTATCAGAATAAGGGCAAAGAAACCCAACTATGAGGTGGGATCTTCTCGGCAACTGTCACTCCCTAAACGCAAAACAGCAGAAAAACCATCTGTGGATCCAGCTGCTGCAAAACTCTGGACTCTGTCAGCTAGTGACATGAATGATGATGATGTGGATATTTTAGACTCGGACGAGCTTCTAGACCAAGAGGACCTGAAGAAACCTGCCCCATCTTCTCTGCTTTGCAGCCGAAAGTGGGGGAAAGAAGGGAGAAGAAAACGAAAACCCTGCAAAAACTGCCACTTTGTGGA
Full Trace Sequence: CGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATGATCTAGCAAACTTAGTGTTTCCTGGTCAGCAAGTTGCTGTGACGTGGGATGGCAGTTCCTCCACAGAAGCTCTGAAGGAGTTTGTATCAAAGTTGCAGGAGGTAGTGGCACTACGGGGCAAGGTCTCTGTTGAGAACATAGAGCGACTGCTGCTTTCTGCTCACGCTGATTCAAGTTTTGATGCCATTCTGCTTGGTATGGTCCAAGGAACTCAGTGCATACACAGCTCTGAAGTACTTGCAGAGGTTGCCCGAATCTTGAAGCCTGGTGGGGCACTGATCATACAAGAGCCAGTGGCAGCCGGAGCTGGGGCTCAGCTCAGGACTCCAGAACACCTCTCCTCTGTGCTTAAACTATCTGGATTAACTGAAGTTACACAGCTGCTGCAAGAGCCCCTAAACCCTGAACAGAAGCAAGGAGTTGTTGAGCTGCTAGGATACAATGGGAATGATGTTAGCACTATCAGAATAAGGGCAAAGAAACCCAACTATGAGGTGGGATCTTCTCGGCAACTGTCACTCCCTAAACGCAAAACAGCAGAAAAACCATCTGTGGATCCAGCTGCTGCAAAACTCTGGACTCTGTCAGCTAGTGACATGAATGATGATGATGTGGATATTTTAGACTCGGACGAGCTTCTAGACCAAGAGGACCTGAAGAAACCTGCCCCATCTTCTCTGCTTTGCAGCCGAAAGTGGGGGAAAGAAGGGAGAAGAAAACGAAAACCCTGCAAAAACTGCCACTTTGTGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGATCTAGCAAACTTAGTG

Sequences - 3ʹ (reverse) EST

Accession: JZ838402
dbEST ID: 79656104
Trimmed Sequence: GGCATCTTGCAGTTTTGTAGGATTCAATAACACCTTCTCTCCTGGTTTAAATGCTGGCATTCCAAGATATGGACAACTAGCACAGCGGAAAGCATCGCCTAGGTAACAATTACCACATGCCGATGGTGCGGCTTTTGGGACAGTGCTTGGAGTCTTTTCTGCTTCCAGCTCTTCTGCTAATCCACAAGTGCAGTTCTTGCAGGCTTTCCGCTTCTTCTCACTTCCTTCCCCACATCCGCTGGCAAGCAGAGAAGATGGGGCAGGTTTCTTCAGGTCCTCTTGGTCTAGAAGCTCGTCCGAGTCTAAAATATCCACATCATCATCATTCATGTCACTAGCTGACAGAGTCCAGAGTTTTGCAGCAGCTGGATCCACAGATGGTTTTTCTGCTGTTTTGCGTTTAGGGAGTGACAGTTGCCGAGAAGATCCCACCTCATAGTTGGGTTTCTTTGCCCTTATTCTGATAGTGCTAACATCATTCCCATTGTATCCTAGCACCTCAGCAACTCCCTGCTTCTGTTCAGGGTTGAGGGGGCTCTTGCGACAGCTGTGGTACCTTCAGTTAATCCAGATAGTTTTAACAACAAAAAAAAAGATTTTCTGGAGTCCCTGAACCTAACCCCAAGCTCCCGCTGCCCCTGGCTCCTTGTGGAATCGGGTGCCCGGGCCGGGGGTTGCGGATGTGGAGGCAAACGACCTCCAAGATACTTTCGGAATTTGAATTTAGTTC
Full Trace Sequence: GGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCATCTTGCAGTTTTGTAGGATTCAATAACACCTTCTCTCCTGGTTTAAATGCTGGCATTCCAAGATATGGACAACTAGCACAGCGGAAAGCATCGCCTAGGTAACAATTACCACATGCCGATGGTGCGGCTTTTGGGACAGTGCTTGGAGTCTTTTCTGCTTCCAGCTCTTCTGCTAATCCACAAGTGCAGTTCTTGCAGGCTTTCCGCTTCTTCTCACTTCCTTCCCCACATCCGCTGGCAAGCAGAGAAGATGGGGCAGGTTTCTTCAGGTCCTCTTGGTCTAGAAGCTCGTCCGAGTCTAAAATATCCACATCATCATCATTCATGTCACTAGCTGACAGAGTCCAGAGTTTTGCAGCAGCTGGATCCACAGATGGTTTTTCTGCTGTTTTGCGTTTAGGGAGTGACAGTTGCCGAGAAGATCCCACCTCATAGTTGGGTTTCTTTGCCCTTATTCTGATAGTGCTAACATCATTCCCATTGTATCCTAGCACCTCAGCAACTCCCTGCTTCTGTTCAGGGTTGAGGGGGCTCTTGCGACAGCTGTGGTACCTTCAGTTAATCCAGATAGTTTTAACAACAAAAAAAAAGATTTTCTGGAGTCCCTGAACCTAACCCCAAGCTCCCGCTGCCCCTGGCTCCTTGTGGAATCGGGTGCCCGGGCCGGGGGTTGCGGATGTGGAGGCAAACGACCTCCAAGATACTTTCGGAATTTGAATTTAGTTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCATCTTGCAGTTTTGTAGGATT