ORFeome > cirbp ORF1 – XORFeome v1.0

cirbp ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cirbp
Gene ID: 492785
Gene Page ID: 492780
ORF Xenbase ID: 17269653

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054250
Original XGC clone length: 501

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: G09

Sequences - 5ʹ (forward) EST

Accession: JZ839495
dbEST ID: 79657197
Trimmed Sequence: ATGTCTGATGAAGGAAAACTCTTTATCGGTGGTCTGAATTTTGACACCAATGAGGAAAGCTTGGAGCAAGTGGTTTAGCAAATATGGGCAGATCTCTGAAGTTGTTGTGGTGAAGGATCGGGAAACAAAGAGATCAAGAGGATTTGGCTTTGTCACATTTGAGAATCCTGATGATGCCAAGGATGCTATGATGGCAATGAATGGGAAGGCTGTAGATGGCCGTCAAATCCGCGTTGATCAGGCTGGCAAGTCTTCTGGTGATAGAAGAGGTGGTTACAGAGGTGGCTCTTCTGGAGGCAGAGGCTTCTTCCGTGGAGGCAGAGGCCGAGGTGGTGGAGACAGAGGATATGGAAGCAGCCGTTTTGATAACAGAAGTGGAGGTTATGGCGGTAGCAGTGGATCCAGGGACTATTATAGCAGTGGCAGGAGTCAAGGCAGCTATGGTGATCGTGCTGGAGGTTCCTACAGAGATAGCTACGACAGTTATGCTACACACGAGTT
Full Trace Sequence: TCGGGGCACCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGATGAAGGAAAACTCTTTATCGGTGGTCTGAATTTTGACACCAATGAGGAAAGCTTGGAGCAAGTGGTTTAGCAAATATGGGCAGATCTCTGAAGTTGTTGTGGTGAAGGATCGGGAAACAAAGAGATCAAGAGGATTTGGCTTTGTCACATTTGAGAATCCTGATGATGCCAAGGATGCTATGATGGCAATGAATGGGAAGGCTGTAGATGGCCGTCAAATCCGCGTTGATCAGGCTGGCAAGTCTTCTGGTGATAGAAGAGGTGGTTACAGAGGTGGCTCTTCTGGAGGCAGAGGCTTCTTCCGTGGAGGCAGAGGCCGAGGTGGTGGAGACAGAGGATATGGAAGCAGCCGTTTTGATAACAGAAGTGGAGGTTATGGCGGTAGCAGTGGATCCAGGGACTATTATAGCAGTGGCAGGAGTCAAGGCAGCTATGGTGATCGTGCTGGAGGTTCCTACAGAGATAGCTACGACAGTTATGCTACACACGAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCATAATAAAATCAATATTTGGCCATCCGGCTGAATACCCCCTATTNTGGAAAAATAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAACTCTGGGACGTGTCTCCAACCCCAAAAAAATAAAAAAAGGATCACTTAATGGAAACCCCTTTTTTTTTGGTGGGTGGTCCCCCGGAGAACACCAAGGAGAAAAAAAACCAGGGGGGAAAAGGACGGTGGTGGTGGGAATAGTGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGATGAAGGAAAACTCTTT

Sequences - 3ʹ (reverse) EST

Accession: JZ839494
dbEST ID: 79657196
Trimmed Sequence: CTCGTGTGTAGCATAACTGTCGTAGCTATCTCTGTAGGAACCTCCAGCACGATCACCATAGCTGCCTTGACTCCTGCCACTGCTATAATAGTCCCTGGATCCACTGCTACCGCCATAACCTCCACTTCTGTTATCAAAACGGCTGCTTCCATATCCTCTGTCTCCACCACCTCGGCCTCTGCCTCCACGGAAGAAGCCTCTGCCTCCAGAAGAGCCACCTCTGTAACCACCTCTTCTATCACCAGAAGACTTGCCAGCCTGATCAACGCGGATTTGACGGCCATCTACAGCCTTCCCATTCATTGCCATCATAGCATCCTTGGCATCATCAGGATTCTCAAATGTGACAAAGCCAAATCCTCTTGATCTCTTTGTTTCCCGATCCTTCACCACAACAACTTCAGAGATCTGCCCATATTTGCTAAACACTTGCTCCGAGCTTTCCTCAATGCTGTCAAAATTCATACCACCGATAAAGAGTTTTCCTTCATCATACATGG
Full Trace Sequence: GGAAACCAGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCGTGTGTAGCATAACTGTCGTAGCTATCTCTGTAGGAACCTCCAGCACGATCACCATAGCTGCCTTGACTCCTGCCACTGCTATAATAGTCCCTGGATCCACTGCTACCGCCATAACCTCCACTTCTGTTATCAAAACGGCTGCTTCCATATCCTCTGTCTCCACCACCTCGGCCTCTGCCTCCACGGAAGAAGCCTCTGCCTCCAGAAGAGCCACCTCTGTAACCACCTCTTCTATCACCAGAAGACTTGCCAGCCTGATCAACGCGGATTTGACGGCCATCTACAGCCTTCCCATTCATTGCCATCATAGCATCCTTGGCATCATCAGGATTCTCAAATGTGACAAAGCCAAATCCTCTTGATCTCTTTGTTTCCCGATCCTTCACCACAACAACTTCAGAGATCTGCCCATATTTGCTAAACACTTGCTCCGAGCTTTCCTCAATGCTGTCAAAATTCATACCACCGATAAAGAGTTTTCCTTCATCATACATGGTGCCAACTTTTATTAACAAAGTTTGGCATTATAAAAAAGCCATGCTCATCAATTTGTTGCAACAAACAAGTCACTATCACCCCAAAATAAAAACAAAAAAAAAAAAAAAAAAAGCATAAGGAACTAGGACCTCATTTAACACAAACCATGGACCGCGGGGGGAAAAAAAGGCCCCCCCCTTCACCCGGGCCCCCTGGGGTGTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCGTGTGTAGCATAACTGTC