ORFeome > clcn6 ORF1 – XORFeome v1.0

clcn6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: clcn6
Gene ID: 6486138
Gene Page ID: 990271
ORF Xenbase ID: 17269743

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124896
Original XGC clone length: 831

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A04

Sequences - 5ʹ (forward) EST

Accession: JZ838795
dbEST ID: 79656497
Trimmed Sequence: ATGGCGTGCTGTGGGGGTTCGGTGTGCTGTTGCTGCGGGAATCGAGAGAGCCGCACCCCAGAGGAATTGACTATACTAGGGGAAACACATGAAGAAGATGAGGAGATTCTACCCCGGAAAGATTATGAAAGCTTGGATTATGACAGATGTATTAGTGATCCATATCTTGAAGTTCTGGAGAGTATCAACTATAAGAGAGCCTGGAGGTACGAGGCAGTGAAATGGATAATGGTCTTTGCTATACGAGTCTGCACACGACTGGTTGGACTCTTTGTAGATTTCTATGTCCAACTCTTCTCCCGCTTTAAATATAGAGATGGTGCAAGGTTGTGTTGAATAATCTACTGAGAGGGGTTGTTTGGTAGGTTAGCTTCAAGAAGGCCGCGCAGGGGGATTGAGTGATAAATATTTTCCCAGGAGACTTAACCATAGATCAACCCGCCGAGGCAGGCTTGGAGGAGGGTAAAAAAAAAGCATTACCGTACGTAACTGCAGGAGGAGGGTCCGGGGCGTCTCTGTACCCACGCCAAAACAAAGGAGGGGGAGGAGGACTTAAAGACAAAGAGGGCAGGAGAGGTGATGACGAGAAGGGGGGGAGGGAAAAGAGTAACAAAAGGGGGCGAGATGAGGGACGAGGGCAGCAGTATCAAGAAACGAACAATGTGGCCGGATGACAGAGGAAAAGAAGATATGTGTTATTATTATACAACACAATAAACACAACAAGAAAGGGGGGGAGGAAAGGAGGAGGAAAGAAAGATAGAGGGGGGTTAAAGTCACGGGGAGAGAAAGGAGGACCTCAGTGGGGGGGGG
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGTGCTGTGGGGGTTCGGTGTGCTGTTGCTGCGGGAATCGAGAGAGCCGCACCCCAGAGGAATTGACTATACTAGGGGAAACACATGAAGAAGATGAGGAGATTCTACCCCGGAAAGATTATGAAAGCTTGGATTATGACAGATGTATTAGTGATCCATATCTTGAAGTTCTGGAGAGTATCAACTATAAGAGAGCCTGGAGGTACGAGGCAGTGAAATGGATAATGGTCTTTGCTATACGAGTCTGCACACGACTGGTTGGACTCTTTGTAGATTTCTATGTCCAACTCTTCTCCCGCTTTAAATATAGAGATGGTGCAAGGTTGTGTTGAATAATCTACTGAGAGGGGTTGTTTGGTAGGTTAGCTTCAAGAAGGCCGCGCAGGGGGATTGAGTGATAAATATTTTCCCAGGAGACTTAACCATAGATCAACCCGCCGAGGCAGGCTTGGAGGAGGGTAAAAAAAAAGCATTACCGTACGTAACTGCAGGAGGAGGGTCCGGGGCGTCTCTGTACCCACGCCAAAACAAAGGAGGGGGAGGAGGACTTAAAGACAAAGAGGGCAGGAGAGGTGATGACGAGAAGGGGGGGAGGGAAAAGAGTAACAAAAGGGGGCGAGATGAGGGACGAGGGCAGCAGTATCAAGAAACGAACAATGTGGCCGGATGACAGAGGAAAAGAAGATATGTGTTATTATTATACAACACAATAAACACAACAAGAAAGGGGGGGAGGAAAGGAGGAGGAAAGAAAGATAGAGGGGGGTTAAAGTCACGGGGAGAGAAAGGAGGACCTCAGTGGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGTGCTGTGGGGGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838794
dbEST ID: 79656496
Trimmed Sequence: AAACATCACTTTCCATGTGAGGCCCTGATTCCAGAATGAGGACCCCTCTTCCAAACTGAATAGCGTACCTCCGATAGGTGCACCAAAAGCAGCAGCTACACCAGCAGCTGCTCCAGCAGATACAAAGTCTCTCTTGTCCCGGTCACTCCTGAAATATGGAAAATCAAAACGTATCTTCTGGAAAGACATGCTCTGAAACTGGGGTAAACCTGCTCCTACAACTGCACCACTGTGAATCATCGGGCCTTCCTTGCCTACAAAAAGACCTCCAGACACACTGAATAAGACGCCCAAAGCCTTGCACACTAATGTACGGAGACGGACTACACCTGGAACCTTCACCCCATTTAGGTAACATTTTATCTCTGGTATCCCAGAACCAGCTGCCACAGGCTGAATTAGGACAAAGAGTGTTGCAATGAAGGTAAAAGTCAAGTTAAATCCCAGGAGCTCCAAAAGTGAAAGTGCCAAACAACCCCTCTCAGTACATTCTTCAACAGAACCTTGCACCACTCTATACTTAGACCGGGAGAAGAGCTGGACAAAGAAATCTACAAAGAGTCCAACCAGTCCTGTGCAGACTCCTATAGCAAAGACCATTAATCCATTCACTGCCTCGTACCTCCCGGCTCTCCTAAAAGTTGATACTCTCCCGAAACTTCAGAATATGGATCACTAAAACATCCTGTCAAAACCCAAGCCTTTCAAAAATCTTTCCCCGGGGGTAAAAATCTCCCTCATCCTTCCTTCATTGGTGTTTCC
Full Trace Sequence: GGGTAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAACATCACTTTCCATGTGAGGCCCTGATTCCAGAATGAGGACCCCTCTTCCAAACTGAATAGCGTACCTCCGATAGGTGCACCAAAAGCAGCAGCTACACCAGCAGCTGCTCCAGCAGATACAAAGTCTCTCTTGTCCCGGTCACTCCTGAAATATGGAAAATCAAAACGTATCTTCTGGAAAGACATGCTCTGAAACTGGGGTAAACCTGCTCCTACAACTGCACCACTGTGAATCATCGGGCCTTCCTTGCCTACAAAAAGACCTCCAGACACACTGAATAAGACGCCCAAAGCCTTGCACACTAATGTACGGAGACGGACTACACCTGGAACCTTCACCCCATTTAGGTAACATTTTATCTCTGGTATCCCAGAACCAGCTGCCACAGGCTGAATTAGGACAAAGAGTGTTGCAATGAAGGTAAAAGTCAAGTTAAATCCCAGGAGCTCCAAAAGTGAAAGTGCCAAACAACCCCTCTCAGTACATTCTTCAACAGAACCTTGCACCACTCTATACTTAGACCGGGAGAAGAGCTGGACAAAGAAATCTACAAAGAGTCCAACCAGTCCTGTGCAGACTCCTATAGCAAAGACCATTAATCCATTCACTGCCTCGTACCTCCCGGCTCTCCTAAAAGTTGATACTCTCCCGAAACTTCAGAATATGGATCACTAAAACATCCTGTCAAAACCCAAGCCTTTCAAAAATCTTTCCCCGGGGGTAAAAATCTCCCTCATCCTTCCTTCATTGGTGTTTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAACATCACTTTCCATGTGAGG