ORFeome > cldn4L2 ORF1 – XORFeome v1.0

cldn4L2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol:
Gene ID: 6256333
Gene Page ID:
ORF Xenbase ID: 17269803

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106698
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G06

Sequences - 5ʹ (forward) EST

Accession: JZ837182
dbEST ID: 79654884
Trimmed Sequence: ATGGCTTCTACTGGTCTCCAGATCCTTGGCATGGCTCTTGCCCTCATTGGCTGGGTGGGATGTATCATCACCTGTGCCCTGCCCATGTGGAGGGTGACTGCTTTCATTGGGAACAACATAGTCGTGGCACAAACCATCTGGGAAGGACTGTGGATGAATTGTATTGTGCAGAGTACCGGACAGATGCAGTGCAAAGTCTACGACTCCATGTTGGCTCTGTCCCAGGACTTGCAGGCTGCCCGTGCCCTTACTGTCATCTGTATTCTGGTAGCCCTGCTAGCCATGCTCATTGGTGTTGTGGGAGCCAAGTGCACAAACTGCATAGAAGACAAGAATGCCAAGGCAAAAGTCAGCATGGTATCTGGCATAGTCTTCCTGGTGGCCGGTATCCTCCTGCTCATCCCTGTCTGCTGGTCTGCAAACAGCATCATCCGTGACTTCTACAATCCGCTGGTGGTGGAGGCTCAGAAGAGAGAACTTGGAGCTGCTTTGTATATTGGGTGGGCTTCTGCTGCTCTCATGCTCCTGGGTGGAGGCCTCCTGTGCTGCTCTTGCCCCAAGAGGGAAGATAATCATTACTCTGCCCAATACACTGCTGCCTCCCAGCCACGAAGTGACTACCCCAGCAAGAACTATGTCTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTACTGGTCTCCAGATCCTTGGCATGGCTCTTGCCCTCATTGGCTGGGTGGGATGTATCATCACCTGTGCCCTGCCCATGTGGAGGGTGACTGCTTTCATTGGGAACAACATAGTCGTGGCACAAACCATCTGGGAAGGACTGTGGATGAATTGTATTGTGCAGAGTACCGGACAGATGCAGTGCAAAGTCTACGACTCCATGTTGGCTCTGTCCCAGGACTTGCAGGCTGCCCGTGCCCTTACTGTCATCTGTATTCTGGTAGCCCTGCTAGCCATGCTCATTGGTGTTGTGGGAGCCAAGTGCACAAACTGCATAGAAGACAAGAATGCCAAGGCAAAAGTCAGCATGGTATCTGGCATAGTCTTCCTGGTGGCCGGTATCCTCCTGCTCATCCCTGTCTGCTGGTCTGCAAACAGCATCATCCGTGACTTCTACAATCCGCTGGTGGTGGAGGCTCAGAAGAGAGAACTTGGAGCTGCTTTGTATATTGGGTGGGCTTCTGCTGCTCTCATGCTCCTGGGTGGAGGCCTCCTGTGCTGCTCTTGCCCCAAGAGGGAAGATAATCATTACTCTGCCCAATACACTGCTGCCTCCCAGCCACGAAGTGACTACCCCAGCAAGAACTATGTCTTGCCAACTTTCTTGTACAAGTTTGGCATTATAAAAAAGCATGGCTTATTAATTTGTTTGCAACGAACAGGTCACTATCAGTCCAAATAAAATCATTATTTTGCCAATCCCGCTTAAATTCCCCCTATAATTGAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAATA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTACTGGTCTC

Sequences - 3ʹ (reverse) EST

Accession: JZ837181
dbEST ID: 79654883
Trimmed Sequence: GACATAGTTCTTGCTGGGGTAGTCACTTCGTGGCTGGGAGGCAGCAGTGTATTGGGCAGAGTAATGATTATCTTCCCTCTTGGGGCAAGAGCAGCACAGGAGGCCTCCACCCAGGAGCATGAGAGCAGCAGAAGCCCACCCAATATACAAAGCAGCTCCAAGTTCTCTCTTCTGAGCCTCCACCACCAGCGGATTGTAGAAGTCACGGATGATGCTGTTTGCAGACCAGCAGACAGGGATGAGCAGGAGGATACCGGCCACCAGGAAGACTATGCCAGATACCATGCTGACTTTTGCCTTGGCATTCTTGTCTTCTATGCAGTTTGTGCACTTGGCTCCCACAACACCAATGAGCATGGCTAGCAGGGCTACCAGAATACAGATGACAGTAAGGGCACGGGCAGCCTGCAAGTCCTGGGACAGAGCCAACATGGAGTCGTAGACTTTGCACTGCATCTGTCCGGTACTCTGCAAAATACCATTCATCCACAATTCCTTCCCAGATGGTTTGGTGCCCGACTATTTTGTTCCAAATGAAAGCAGTCACCCCTCACATGGGGCAGGGCACAGGGGAATGAACGTTCCACCCAGCCCAATGGGGGCAAGAGCCATGGCAAGGATCTGGAAACCAGTTAAAAGCCATGGTGGCCACCTTTGNTGTACAAGGGTTGGCATTAAATAAAAAACCATTTGCTTCATCAATTTGGTTGG
Full Trace Sequence: GGGAAACGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACATAGTTCTTGCTGGGGTAGTCACTTCGTGGCTGGGAGGCAGCAGTGTATTGGGCAGAGTAATGATTATCTTCCCTCTTGGGGCAAGAGCAGCACAGGAGGCCTCCACCCAGGAGCATGAGAGCAGCAGAAGCCCACCCAATATACAAAGCAGCTCCAAGTTCTCTCTTCTGAGCCTCCACCACCAGCGGATTGTAGAAGTCACGGATGATGCTGTTTGCAGACCAGCAGACAGGGATGAGCAGGAGGATACCGGCCACCAGGAAGACTATGCCAGATACCATGCTGACTTTTGCCTTGGCATTCTTGTCTTCTATGCAGTTTGTGCACTTGGCTCCCACAACACCAATGAGCATGGCTAGCAGGGCTACCAGAATACAGATGACAGTAAGGGCACGGGCAGCCTGCAAGTCCTGGGACAGAGCCAACATGGAGTCGTAGACTTTGCACTGCATCTGTCCGGTACTCTGCAAAATACCATTCATCCACAATTCCTTCCCAGATGGTTTGGTGCCCGACTATTTTGTTCCAAATGAAAGCAGTCACCCCTCACATGGGGCAGGGCACAGGGGAATGAACGTTCCACCCAGCCCAATGGGGGCAAGAGCCATGGCAAGGATCTGGAAACCAGTTAAAAGCCATGGTGGCCACCTTTGNTGTACAAGGGTTGGCATTAAATAAAAAACCATTTGCTTCATCAATTTGGTTGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACATAGTTCTTGCTGGG