ORFeome > cldn7 ORF1 – XORFeome v1.0

cldn7 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cldn7
Gene ID: 6078955
Gene Page ID: 5786133
ORF Xenbase ID: 17269827

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC048771
Original XGC clone length: 642

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GCCAAATAGATTTTATTTTGACTGTTATAGACCTGTTCTTTGCTCACATTGATGAGCAATGCTTTTTTTTATTGCCAACTTTGTACAAAAAAGTTGTGTCACTGGCCAACTCCGGGCTGCAGCTCCTCGGTTTCGTGCTGGCTATGTTGGGTTGGATCGCACTGATCGCAGCCACTATTATGCCCCAGTGGAAGATGTCCTCGTACGCCGGGGACCTGACTCATCACCGCCCTGGCCATTTATCAGGGACTGTGGATGAGTTGCGCCACTCCGAGCACCGGGCAAATCAAGTGCTGAGTCTATGACTCCTTATTACAGCTGGACGCATCTCTGCAGGCCACCCGGGCCCTCGGGGTGGTGTCCATCATCCTGGGCCTACTTTGGAATTGCCGTATCTACCATGGGCATGAAATGCACCACCTGTGGGGGAGATAATCACGCGAAAAAGTCTCGCGTTGAAATGACTGGTGGATTTGTCTTTCACCGTGGGGGTCTTGCATCTCTCAGTGGTTGCTCCCGCTATGGCAATCAGATTCATTGGGGATTACTACAACCCTCGGCTGTCCATCATGCCCGAGTACGAGTTTGGCGCTGTTGAGTTCTTTGTCTGGGCCGGTTCCTTCTTGGGCCTGTTAGTAGGAGGTCTGTTTCCCTGCTGGCGATCACGCAAGGATTTCCGTCCAGAAGGGGTACCTCCAGTGTGGAGCCAGGTCCCCGTTCCGGAGGTTGGAAAGGAACTATGTCTGGCAGGTTTTTCTGTCCCAGCCGCCTTATAAAAAAAAGATTCGATATCAAATAATTGCGAAAACCGGTTTCCTAAAAAAAAGAATAAAATAATAAAAAACCAACACCCCTAATTTTCTCTCTGGGGGGGGGGGGGGGGTGCGGGGGGGCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCAACTCCGGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829646
dbEST ID: 79647348
Trimmed Sequence: GACATAGTCCCTTCCAGAAGATGGAACTTTAGACTTCGCTCCAGACTTGGGGTACCCCTTCTGGTAGTTATTCTTGCGGGAACATGAGCACGACAACAGGCCTCCTCCTATAAGAACCAGGAAGGAACCGGCCCAGCCAAGGAACACACCAGCACCAAACTCATACTTGGTATTGATTGGCAGAAGAGGGTTGTAGAAATCCCGAATAATCTGATTGCCATACCAGGAGCAGGCAATGAGAGCTGCAAGACCCCCAAGGAGAAAGACAAATCCACCAGTCATTGCAATGCGAGACTTTTTCACCTTATCATCTCCCCCACAGGTTGTGCATTTCATGCCCATGGTAGATACGGCAATTCCAAATATGCCCAGGATGATGGAGACCACCATGAGGGCCCGGGTGGCCTGCAGAGATGCGTCCAGCTGTAATATGGAGTCATAGACTTTGCACTGGATTTGCCCGGTGCTCTGAGTGGCGCAACTCATCCACAGTCCCTGATAAATGGCCACGGCGGTGATGATCTGGTCCCCGGCGTACGAGGACATCTTCCACTGGGGCATAATAGTCGCTGCGATCAGTGCGATCCAACCAACATCGCCAGCACGAAGCCGAGGAGCTGCAGCCCCGGAGTGGGCCATGGTGGC
Full Trace Sequence: CGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACATAGTCCCTTCCAGAAGATGGAACTTTAGACTTCGCTCCAGACTTGGGGTACCCCTTCTGGTAGTTATTCTTGCGGGAACATGAGCACGACAACAGGCCTCCTCCTATAAGAACCAGGAAGGAACCGGCCCAGCCAAGGAACACACCAGCACCAAACTCATACTTGGTATTGATTGGCAGAAGAGGGTTGTAGAAATCCCGAATAATCTGATTGCCATACCAGGAGCAGGCAATGAGAGCTGCAAGACCCCCAAGGAGAAAGACAAATCCACCAGTCATTGCAATGCGAGACTTTTTCACCTTATCATCTCCCCCACAGGTTGTGCATTTCATGCCCATGGTAGATACGGCAATTCCAAATATGCCCAGGATGATGGAGACCACCATGAGGGCCCGGGTGGCCTGCAGAGATGCGTCCAGCTGTAATATGGAGTCATAGACTTTGCACTGGATTTGCCCGGTGCTCTGAGTGGCGCAACTCATCCACAGTCCCTGATAAATGGCCACGGCGGTGATGATCTGGTCCCCGGCGTACGAGGACATCTTCCACTGGGGCATAATAGTCGCTGCGATCAGTGCGATCCAACCAACATCGCCAGCACGAAGCCGAGGAGCTGCAGCCCCGGAGTGGGCCATGGTGGCCAACTTTTTTGTACAAAGTTGGGCATTATAAAAAAGCATTGGTTCATCAATTTGTGGCAACGAAAAAGGTCACTATCAGTTCAAAATAAAAGACAATTTATTTTGGGGGGCCCGAAACCTAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACATAGTCCCTTCCAGAAGAT