ORFeome > clec3b ORF1 – XORFeome v1.0

clec3b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: clec3b
Gene ID: 945748
Gene Page ID: 945742
ORF Xenbase ID: 17269845

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129773
Original XGC clone length: 597

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: JZ838695
dbEST ID: 79656397
Trimmed Sequence: ATGGAGTACAGGAGAGCCTGCGTCCTCTTATGTCTCTTCTGCTTTGCCCAGGTCACTTTTCAACAGAATGGCAAAAAAAATAAGCAGAACAATAAAGATGTGGTTAGCCTGAAAATGTATGAGGAATTAAAGCAGAAAGTTCAGAACATCGAATTAGAAGTCATTCACCTTAAGGAACAGCAGGCGCTGCAGACAATTTGCCTGAAAGGGGTGCAGATCTACAACAAATGCTTCCTGGCCTTTAATGAGTTAAAGGCCTACCACCAGGCCAGTGATATGTGCTTTGCCCAAGGGGGAACACTGAGTACTCCGGAGACTGGAGATGAGAATGACTCCTTGTACGATTATGTGCGCAAGAGTATTGGCTCCAGCGCTGAGATCTGGCTTGGCATTAATGACATGGCTACAGAGGGGAACTGGCAAGATCTAAATGGGAGCCCCGTTACCTTTAAACATTGGGAGACTGAAATCACGAAACAGCCTGACGGGGGAAAGCAGGAGAACTGTGCAGCGATGTCGGTTACAGCTATTGGCAAGTGGTTCGACAAAAACTGCAAAACAAAACTCCCTTTTGTGTGTCAGTTTTCTATTGTTTT
Full Trace Sequence: CTCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTACAGGAGAGCCTGCGTCCTCTTATGTCTCTTCTGCTTTGCCCAGGTCACTTTTCAACAGAATGGCAAAAAAAATAAGCAGAACAATAAAGATGTGGTTAGCCTGAAAATGTATGAGGAATTAAAGCAGAAAGTTCAGAACATCGAATTAGAAGTCATTCACCTTAAGGAACAGCAGGCGCTGCAGACAATTTGCCTGAAAGGGGTGCAGATCTACAACAAATGCTTCCTGGCCTTTAATGAGTTAAAGGCCTACCACCAGGCCAGTGATATGTGCTTTGCCCAAGGGGGAACACTGAGTACTCCGGAGACTGGAGATGAGAATGACTCCTTGTACGATTATGTGCGCAAGAGTATTGGCTCCAGCGCTGAGATCTGGCTTGGCATTAATGACATGGCTACAGAGGGGAACTGGCAAGATCTAAATGGGAGCCCCGTTACCTTTAAACATTGGGAGACTGAAATCACGAAACAGCCTGACGGGGGAAAGCAGGAGAACTGTGCAGCGATGTCGGTTACAGCTATTGGCAAGTGGTTCGACAAAAACTGCAAAACAAAACTCCCTTTTGTGTGTCAGTTTTCTATTGTTTTGCCAACTTTCTTGTACAAAGTTGGCATTAAAAGAAAGCATTTGCTAACAATTTGTTGCAACAAACAAGGTAACTATCAGTCCAAAATAAAATCATTTATTTTCCCATCAGCCTAAAATCCCCCAAAGTGAGATTGTAAAAAAAAAAAAAAAACTGATTTTCCTGGGCACCTCGGGCCCCGTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTACAGGAGAGCCTGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838694
dbEST ID: 79656396
Trimmed Sequence: AACAATAGAAAACTGACACACAAAAGGGAGTTCTGTTTTGCAGTTTTTGTCGAACCACTTGCCAATAGCTGTAACCGACATCGCTGCACAGTTCTCCTGCTTTCCCCCGTCAGGCTGTTTCGTGATTTCAGTCTCCCAATGTTTAAAGGTAACGGGGCTCCCATTTAGATCTTGCCAGTTCCCCTCTGTAGCCATGTCATTAATGCCAAGCCAGATCTCAGCGCTGGAGCCAATACTCTTGCGCACATAATCGTACAAGGAGTCATTCTCATCTCCAGTCTCCGGAGTACTCAGTGTTCCCCCTTGGGCAAAGCACATATCACTGGCCTGGTGGTAGGCCTTTAACTCATTAAAGGCCAGGAAGCATTTGTTGTAGATCTGCACCCCTTTCAGGCAAATTGTCTGCAGCGCCTGCTGTTCCTTAAGGTGAATGACTTCTAATTCGATGTTCTGAACTTTCTGCTTTAATTCCTCATACATTTTCAGGCTAACCACATCTTTATTGTTCTGCTTATTTTTTTTTGCCTTTCTGTGAAAAGTGACCTGGGCCAAACCAAAGAAAACTAAGAAGGACCCAGGCTCTCCTGTAATCCATGGTGCCC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAACAATAGAAAACTGACACACAAAAGGGAGTTCTGTTTTGCAGTTTTTGTCGAACCACTTGCCAATAGCTGTAACCGACATCGCTGCACAGTTCTCCTGCTTTCCCCCGTCAGGCTGTTTCGTGATTTCAGTCTCCCAATGTTTAAAGGTAACGGGGCTCCCATTTAGATCTTGCCAGTTCCCCTCTGTAGCCATGTCATTAATGCCAAGCCAGATCTCAGCGCTGGAGCCAATACTCTTGCGCACATAATCGTACAAGGAGTCATTCTCATCTCCAGTCTCCGGAGTACTCAGTGTTCCCCCTTGGGCAAAGCACATATCACTGGCCTGGTGGTAGGCCTTTAACTCATTAAAGGCCAGGAAGCATTTGTTGTAGATCTGCACCCCTTTCAGGCAAATTGTCTGCAGCGCCTGCTGTTCCTTAAGGTGAATGACTTCTAATTCGATGTTCTGAACTTTCTGCTTTAATTCCTCATACATTTTCAGGCTAACCACATCTTTATTGTTCTGCTTATTTTTTTTTGCCTTTCTGTGAAAAGTGACCTGGGCCAAACCAAAGAAAACTAAGAAGGACCCAGGCTCTCCTGTAATCCATGGTGCCCAGCTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATTCAATTTTGTGCAAACCAAACAGGTCAAAAAAAAAAAAAAAAAAAAAAAACAAAAAATGAGAGGCCCAAGACTTAAAAAACTGGGCGCTCGTTTAAAAAAAACTCCAAATGAACCGGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACAATAGAAAACTGACACACAA