ORFeome > clic6 ORF1 – XORFeome v1.0

clic6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: clic6
Gene ID: 6488882
Gene Page ID: 6039571
ORF Xenbase ID: 17269869

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056036
Original XGC clone length: 753

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11020
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ824618
dbEST ID: 79642320
Trimmed Sequence: ATGACAGACTCTGCTCCCACCAACGGGGAGGAACGGGATCCGGACATAGAACTTTTTGTTAAGGCTGGGAGCGATGGAGAGAGCATAGGGAACTGCCCCTTCTCCCAGCGCCTGTTTATGATCCTCTGGCTCAAAGGAGTTGTGTTCAACGTTACAACAGTAGACCTGAAAAGAAAACCAGCTGACCTCCATAACTTAGCCCCCGGGACTCACCCACCTTTCCTGACCTTCAATGGGGAAGTGAAAACGGATGTGAACAAGATAGAGGAATTTCTGGAGGAAACATTGGCACCACCAAGATACCCCAGACTGGCTGCAAAACATCGTGAGTCCAACTCTGCCGGGATCGACGTCTTTTCCAGATTCTCAGCGTACATTAAAAACACAAAGCAGCAGGATAATGCCGCCTTACAGAAGGGTCTGACAAAAGCCCTGAAGAAACTCGATGACTATCTGAACACACCGTTGCCTGAAGAGATCGATGCCAACAGTCGGGAGGAAGAGAGAGTTTCCAAGAGGATGTTTTTAGATGGAGATGAGTTTACGTTGGCTGACTGTAACCTACTGCCCAAGCTCCATGTTGTGAAGATTGTCGCCNAGAAATACCGTAACTATGAAATCTCCTCGGATATGAGCGGCATCTGGCGGTACCTGAAAAATGCTTATGCAAGGGATGAGTTTACCAATACGTGCGCAGCGGATAAGAGACAGAGCTCGCCTACGCTGACGTGGCCNAAGGGCTCTCAAAAGTTGCCCACTTTCNTGTACAAAGTTGGNCATAATAAGAAAAGCATTGCCTTTATTCAATTTGGTTTGGCAACGAACAGG
Full Trace Sequence: ATTTATTGATTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACAGACTCTGCTCCCACCAACGGGGAGGAACGGGATCCGGACATAGAACTTTTTGTTAAGGCTGGGAGCGATGGAGAGAGCATAGGGAACTGCCCCTTCTCCCAGCGCCTGTTTATGATCCTCTGGCTCAAAGGAGTTGTGTTCAACGTTACAACAGTAGACCTGAAAAGAAAACCAGCTGACCTCCATAACTTAGCCCCCGGGACTCACCCACCTTTCCTGACCTTCAATGGGGAAGTGAAAACGGATGTGAACAAGATAGAGGAATTTCTGGAGGAAACATTGGCACCACCAAGATACCCCAGACTGGCTGCAAAACATCGTGAGTCCAACTCTGCCGGGATCGACGTCTTTTCCAGATTCTCAGCGTACATTAAAAACACAAAGCAGCAGGATAATGCCGCCTTACAGAAGGGTCTGACAAAAGCCCTGAAGAAACTCGATGACTATCTGAACACACCGTTGCCTGAAGAGATCGATGCCAACAGTCGGGAGGAAGAGAGAGTTTCCAAGAGGATGTTTTTAGATGGAGATGAGTTTACGTTGGCTGACTGTAACCTACTGCCCAAGCTCCATGTTGTGAAGATTGTCGCCNAGAAATACCGTAACTATGAAATCTCCTCGGATATGAGCGGCATCTGGCGGTACCTGAAAAATGCTTATGCAAGGGATGAGTTTACCAATACGTGCGCAGCGGATAAGAGACAGAGCTCGCCTACGCTGACGTGGCCNAAGGGCTCTCAAAAGTTGCCCACTTTCNTGTACAAAGTTGGNCATAATAAGAAAAGCATTGCCTTTATTCAATTTGGTTTGGCAACGAACAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGACTCTGCTCCCACCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ829968
dbEST ID: 79647670
Trimmed Sequence: CTTTGAGAGCCTTTTGGCCACGTCAGCGTAGGCGAGCTCTGTCTCTTTATCCGCTGCGCACGTATTGGTAAACTCATCCCTTGCATAAGCATTTTTCAGGTACCGCCAGATGCCGCTCATATCCGAGGAGATTTCATAGTTACGGTATTTCTTGGCGACAATCTTCACAACATGGAGCTTGGGCAGTAGGTTACAGTCAGCCAACGTAAACTCATCTCCATCTAAAAACATCCTCTTGGAAACTCTCTCTTCCTCCCGACTGTTGGCATCGATCTCTTCAGGCAACGGTGTGTTCAGATAGTCATCGAGTTTCTTCAGGGCTTTTGTCAGACCCTTCTGTAAGGCGGCATTATCCTGCTGCTTTGTGTTTTTAATGTACGCTGAGAATCTGGAAAAGACGTCGATCCCGGCAGAGTTGGACTCACGATGTTTTGCAGCCAGTCTGGGGTATCTTGGTGGTGCCAATGTTTCCTCCAGAAATTCCTCTATCTTGTTCACATCCGTTTTCACTTCCCCATTGAAGGTCAGGAAAGGTGGGTGAGTCCCGGGGGCTAAGTTATGGAGGTCAGCTGGTTTTCTTTTCAGGTCTACTGTTGTAAACGTGAACACAACTCCCTTGAGCCCGAAGATCATAAACGGGCGCTGGGAAAAAGGGGCAGTTTCCTAATGCTCTCTCCATCGCTCCCCAGCCCTAACAAAAAAGTTCCTAGTTCCGGAACCCCGTTCCCTCCCCCGTTGGGGGGGAAACCAGAATTCGGGTCCG
Full Trace Sequence: AGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTGAGAGCCTTTTGGCCACGTCAGCGTAGGCGAGCTCTGTCTCTTTATCCGCTGCGCACGTATTGGTAAACTCATCCCTTGCATAAGCATTTTTCAGGTACCGCCAGATGCCGCTCATATCCGAGGAGATTTCATAGTTACGGTATTTCTTGGCGACAATCTTCACAACATGGAGCTTGGGCAGTAGGTTACAGTCAGCCAACGTAAACTCATCTCCATCTAAAAACATCCTCTTGGAAACTCTCTCTTCCTCCCGACTGTTGGCATCGATCTCTTCAGGCAACGGTGTGTTCAGATAGTCATCGAGTTTCTTCAGGGCTTTTGTCAGACCCTTCTGTAAGGCGGCATTATCCTGCTGCTTTGTGTTTTTAATGTACGCTGAGAATCTGGAAAAGACGTCGATCCCGGCAGAGTTGGACTCACGATGTTTTGCAGCCAGTCTGGGGTATCTTGGTGGTGCCAATGTTTCCTCCAGAAATTCCTCTATCTTGTTCACATCCGTTTTCACTTCCCCATTGAAGGTCAGGAAAGGTGGGTGAGTCCCGGGGGCTAAGTTATGGAGGTCAGCTGGTTTTCTTTTCAGGTCTACTGTTGTAAACGTGAACACAACTCCCTTGAGCCCGAAGATCATAAACGGGCGCTGGGAAAAAGGGGCAGTTTCCTAATGCTCTCTCCATCGCTCCCCAGCCCTAACAAAAAAGTTCCTAGTTCCGGAACCCCGTTCCCTCCCCCGTTGGGGGGGAAACCAGAATTCGGGTCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTGAGAGCCTTTTGGCCAC