ORFeome > clta ORF2 – XORFeome v1.0

clta ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: clta
Gene ID: 6256467
Gene Page ID: 944168
ORF Xenbase ID: 17269953

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123251
Original XGC clone length: 612

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11092
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ838815
dbEST ID: 79656517
Trimmed Sequence: ATGGCTGAGTTTGACGTGTTCGGCTCTGTAGGTAACGGGGTATCGGCTGAAGAGGACCCAGCCGCCGCTTTCCTGGCACAGCAGGAGAGTGAAATTGCCGGCATTGAAAATGACGAAGGTTTTAGCATCCTAGACAGTGGGGAGCTACCAATGTCACTACAAGCAGGGGATGGGGCCTCAGATACTGTTATGAATGGGGACTTTTATCAGGAGACAAATGGACCAACAGATGGCTATGCAGCCATTTCACACGCTGACCGCCTACNAGCTGAGCCAGAGAGCATTCGCAAGTGGAGGGAAGAACAGAGAAGCCGTCTAGAAATGTTAGATGCAGACTCGAAAAAGCAAGAGTCTGAATGGAAGGAGAGAGCCAGCAACGAACTGGAGGAGTGGTATGCCAGGCAGGATGAACTGTTAGAGAAGACTAATGCAAACGACCGGGCTGCGGAAGAGGCTTTCCTAAGTGATGTTGAGCAGACCAGCGCCCGGGACGGAAGAGGGAGGGAGGTTGCTATTCTATGTGACGTCCACCCCACATGCAATAGAGCACACCAGAGTAAATTTTCCGGCGGGCGGTCCGTTTTGATCAGGCGGGGGGAGGCGGGGGTAGGGTGGGGTGCCCCCCTTTCAGTGGCGAGGAGGTGGGTGGGTGGAGAGAGATGATGGTCAGTCTGGTAGTGTGGGGGGTTGGGCGGAGGGGGGGAAAGTGAAATATATATTATGGGTTCAGCGGGGGGGGCGCCGAGGGGACAGNGAAAAAAAAAAAAAAAAAAAAAAGGAAAAATAAAAAACACAA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGTTTGACGTGTTCGGCTCTGTAGGTAACGGGGTATCGGCTGAAGAGGACCCAGCCGCCGCTTTCCTGGCACAGCAGGAGAGTGAAATTGCCGGCATTGAAAATGACGAAGGTTTTAGCATCCTAGACAGTGGGGAGCTACCAATGTCACTACAAGCAGGGGATGGGGCCTCAGATACTGTTATGAATGGGGACTTTTATCAGGAGACAAATGGACCAACAGATGGCTATGCAGCCATTTCACACGCTGACCGCCTACNAGCTGAGCCAGAGAGCATTCGCAAGTGGAGGGAAGAACAGAGAAGCCGTCTAGAAATGTTAGATGCAGACTCGAAAAAGCAAGAGTCTGAATGGAAGGAGAGAGCCAGCAACGAACTGGAGGAGTGGTATGCCAGGCAGGATGAACTGTTAGAGAAGACTAATGCAAACGACCGGGCTGCGGAAGAGGCTTTCCTAAGTGATGTTGAGCAGACCAGCGCCCGGGACGGAAGAGGGAGGGAGGTTGCTATTCTATGTGACGTCCACCCCACATGCAATAGAGCACACCAGAGTAAATTTTCCGGCGGGCGGTCCGTTTTGATCAGGCGGGGGGAGGCGGGGGTAGGGTGGGGTGCCCCCCTTTCAGTGGCGAGGAGGTGGGTGGGTGGAGAGAGATGATGGTCAGTCTGGTAGTGTGGGGGGTTGGGCGGAGGGGGGGAAAGTGAAATATATATTATGGGTTCAGCGGGGGGGGCGCCGAGGGGACAGNGAAAAAAAAAAAAAAAAAAAAAAGGAAAAATAAAAAACACAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGTTTGACGTGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838814
dbEST ID: 79656516
Trimmed Sequence: GTGAACCAATGGAGACTGCTTAAGGGTGATCAAAACGGAGCGCATGCGGGAAACGTCTTTCGTCTGTTTACTGGACTTGGGGTTGAAGTCACATAGACGAGCAACGCGCTCCCATTCTGTCCCTGGGCTGGTCTCTTCAACATCACTCACGAAAGCCTCTTCAGCAGCCCGATTGTTTGCTTTAGTCTTCTGTAACAGTTCATCCTGCCTGGCATACCACTCCTCCAGTTCCTTGCTGGCTTTCTCCTTCCATTCAGACTCTTGCTTTTTCGAGTTTGCATCTAACATTTCTAGACGGCTTCTCTGCTCTTCCCTCCACTTGCGAATGCTCTCTGGCTCAGCTTGTAGGCGGTCAGCGTGTGAAATGGCTGCATAGCCATCTGTTGGTCCATTTGTCTCCTGATAAAAGTCCCCATTCATAACAGTATCTGAGGCCCCATCCCCTGCTTGTAGTGACATTGGTAGCTCCCCACTGTCTAGGATGCTAAAACCTTCGTCATTTTCAATGCCGGCGATTTCACTCTCCTGCTGTGCCAGGAAAGCGGCCGCCGGGGTCCTCTTCACCCCATACCCCGTTACCTACAGAACCGAAAACGTAAAACTCAGCCCAGGGTGCCGACGTTGCTTGTACAAGTTGGGAATAGTAAAAGAGAATTGATCATCCATTTGGTGGCAGCAAACAGGGTTCACAAAAAAACAGAAAAAAAAATAAAAATTTTCTGGAC
Full Trace Sequence: AGCAGTGGGTAATACCGACTCACTATNAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGAACCAATGGAGACTGCTTAAGGGTGATCAAAACGGAGCGCATGCGGGAAACGTCTTTCGTCTGTTTACTGGACTTGGGGTTGAAGTCACATAGACGAGCAACGCGCTCCCATTCTGTCCCTGGGCTGGTCTCTTCAACATCACTCACGAAAGCCTCTTCAGCAGCCCGATTGTTTGCTTTAGTCTTCTGTAACAGTTCATCCTGCCTGGCATACCACTCCTCCAGTTCCTTGCTGGCTTTCTCCTTCCATTCAGACTCTTGCTTTTTCGAGTTTGCATCTAACATTTCTAGACGGCTTCTCTGCTCTTCCCTCCACTTGCGAATGCTCTCTGGCTCAGCTTGTAGGCGGTCAGCGTGTGAAATGGCTGCATAGCCATCTGTTGGTCCATTTGTCTCCTGATAAAAGTCCCCATTCATAACAGTATCTGAGGCCCCATCCCCTGCTTGTAGTGACATTGGTAGCTCCCCACTGTCTAGGATGCTAAAACCTTCGTCATTTTCAATGCCGGCGATTTCACTCTCCTGCTGTGCCAGGAAAGCGGCCGCCGGGGTCCTCTTCACCCCATACCCCGTTACCTACAGAACCGAAAACGTAAAACTCAGCCCAGGGTGCCGACGTTGCTTGTACAAGTTGGGAATAGTAAAAGAGAATTGATCATCCATTTGGTGGCAGCAAACAGGGTTCACAAAAAAACAGAAAAAAAAATAAAAATTTTCTGGAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAACCAATGGAGACTGCTT