ORFeome > clu ORF1 – XORFeome v1.0

clu ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: clu
Gene ID: 5940819
Gene Page ID: 5940736
ORF Xenbase ID: 17269971

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC046678
Original XGC clone length: 1344

Human orthology & disease relationships

NCBI Entrez ID: 1191
Ensembl gene IDs: ENSG00000120885
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 104300,104310,123400,131300,137440,154705,225060,245300,600072,600376,603218,606688,609192

Library Location

Plate ID: GDExl11012
Well Location: H01

Sequences - 5ʹ (forward) EST

Accession: JZ823965
dbEST ID: 79641667
Trimmed Sequence: ATGAACATGTACAAGTTTCCTTTCCTCCTTGTGGGTCTCCTTGTGGGTCTCAGCGCTGCAGTTCTACCACCCGAAAACCTGAACCAGATTTCCATAGAGGGGAGTCGCTACATCACAGAACAGGTGGAGAATGCGGTAAATGGAGTAAAAAAGATGAAATCGATCATGGACCAAACTGGGAAAGAACATCAGGAAATCATGCGCAACCTGGAGGAGACCAAAAAGAATAAAGAGGAAGCCCTAAAGAGAGCCTTAGACACAGAGCAGGAGCTTGAGGAGAAGAAGGAAGTGTGCAATGAGACCATGTTGGCTCTCTGGGAGGAGTGCAAGCCCTGCCTGAAACAGACCTGTGTGAGGTTCTACTCCAAAACCTGCAGGAGCGGCTCTGGCCTTGTAGGGCGCCAGTTTGAAGAATTCCTGAACCGATCTTCTCCATTCTCCATTTTCATCAACGGAGAGAAGATCAACTCGCTGACACAGGAGGGGGAACAGCAGCACATGACCTTGGATGACCTTGAGGGTGGATACAGCCTGGTGGAAGACAGTGTCGATGAGCTCTTCAGGGAGAGCATCAAGGCCTTTGGGCAAATGAAGCCGTTCTTCAGCAATTCCTTCCATAATGGATTCTTTGAGTCTCAGTGGAACCCATTTCCCTTCCAGCGAGTCGGGTTTCCCTTTTCTGAGTCTCGCCAGGCAAGATCTCCCACAATCAACCCCCTACTCTCTGGGGGACTTGGAGTCGCTTAATAAAAACAACCACAAAAAAAGAAGGGGAAAAAAATCACCCACCTTTGTCCCCAGGGTTTGGAGGGGG
Full Trace Sequence: GTCCTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACATGTACAAGTTTCCTTTCCTCCTTGTGGGTCTCCTTGTGGGTCTCAGCGCTGCAGTTCTACCACCCGAAAACCTGAACCAGATTTCCATAGAGGGGAGTCGCTACATCACAGAACAGGTGGAGAATGCGGTAAATGGAGTAAAAAAGATGAAATCGATCATGGACCAAACTGGGAAAGAACATCAGGAAATCATGCGCAACCTGGAGGAGACCAAAAAGAATAAAGAGGAAGCCCTAAAGAGAGCCTTAGACACAGAGCAGGAGCTTGAGGAGAAGAAGGAAGTGTGCAATGAGACCATGTTGGCTCTCTGGGAGGAGTGCAAGCCCTGCCTGAAACAGACCTGTGTGAGGTTCTACTCCAAAACCTGCAGGAGCGGCTCTGGCCTTGTAGGGCGCCAGTTTGAAGAATTCCTGAACCGATCTTCTCCATTCTCCATTTTCATCAACGGAGAGAAGATCAACTCGCTGACACAGGAGGGGGAACAGCAGCACATGACCTTGGATGACCTTGAGGGTGGATACAGCCTGGTGGAAGACAGTGTCGATGAGCTCTTCAGGGAGAGCATCAAGGCCTTTGGGCAAATGAAGCCGTTCTTCAGCAATTCCTTCCATAATGGATTCTTTGAGTCTCAGTGGAACCCATTTCCCTTCCAGCGAGTCGGGTTTCCCTTTTCTGAGTCTCGCCAGGCAAGATCTCCCACAATCAACCCCCTACTCTCTGGGGGACTTGGAGTCGCTTAATAAAAACAACCACAAAAAAAGAAGGGGAAAAAAATCACCCACCTTTGTCCCCAGGGTTTGGAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACATGTACAAGTTTCCTTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ829274
dbEST ID: 79646976
Trimmed Sequence: GGCAGCCTCAACAACCTCCGTTTTGAACTTCTTGAGGGCTTCCTCAGCCACCAGCTCCCCAAACATTGGATCATCCATAGAGATGTATCCGGGCAACGTGAAGGTAATTGGGTCAGAGTCAAATACGTTGACAGTCACTTTGGTGTCCGAAGGAGACTCCCCCTCTTTGGAATAGATCGTGGAAACTTGGAAGATCCCATTCTTTCCGCTCTGGGTCATGTTGGCGAACTTAGAAAGCCACCCAAACTGTTTGTTCAGCTGCTCCAATATACCCGTGGTGTTGAACATCTTCTCCCGAAATTGTTCCAGTAAGTCATCGTATTGCCTGGTGAACTTCTCAGCAAGGCGCAGGGAGTCTTGAAACACCTCCTGCAGGTGCTCCTGCACGGGATCCTTCCCAGTACAATCTACTGCTAAAATCTCCTTGCACTTCTCACACTTTTCCTGCATCTTTAAGCAGCTGGCTGAATTGCGACGGAGTTCCTTACAGACCAACTTATCATCCGAATCATTGCCATTTCCCCTAATGGAGCCCAGTCCATCCAACCTTGGGACAAAGTGGTGACTTCTTTCCATCATTTTTTGTGCTGCTTCTATTAGCGACTCANAGTTCCCAGAAGAGTAAGGGGTGAAATGTGGGGAGATCTTGCCCTGGGCGAGACTCAGAAAAAGGGGAACCCCGACTCCCCTTGAAAGGGAAATGGGGTTTCCACTGGAGACTCCAAAGAAACCCATTAAGGGAAAGGAAATTTGCTGAAAAGAAAGGGCCTCCCTT
Full Trace Sequence: CTACACGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGCAGCCTCAACAACCTCCGTTTTGAACTTCTTGAGGGCTTCCTCAGCCACCAGCTCCCCAAACATTGGATCATCCATAGAGATGTATCCGGGCAACGTGAAGGTAATTGGGTCAGAGTCAAATACGTTGACAGTCACTTTGGTGTCCGAAGGAGACTCCCCCTCTTTGGAATAGATCGTGGAAACTTGGAAGATCCCATTCTTTCCGCTCTGGGTCATGTTGGCGAACTTAGAAAGCCACCCAAACTGTTTGTTCAGCTGCTCCAATATACCCGTGGTGTTGAACATCTTCTCCCGAAATTGTTCCAGTAAGTCATCGTATTGCCTGGTGAACTTCTCAGCAAGGCGCAGGGAGTCTTGAAACACCTCCTGCAGGTGCTCCTGCACGGGATCCTTCCCAGTACAATCTACTGCTAAAATCTCCTTGCACTTCTCACACTTTTCCTGCATCTTTAAGCAGCTGGCTGAATTGCGACGGAGTTCCTTACAGACCAACTTATCATCCGAATCATTGCCATTTCCCCTAATGGAGCCCAGTCCATCCAACCTTGGGACAAAGTGGTGACTTCTTTCCATCATTTTTTGTGCTGCTTCTATTAGCGACTCANAGTTCCCAGAAGAGTAAGGGGTGAAATGTGGGGAGATCTTGCCCTGGGCGAGACTCAGAAAAAGGGGAACCCCGACTCCCCTTGAAAGGGAAATGGGGTTTCCACTGGAGACTCCAAAGAAACCCATTAAGGGAAAGGAAATTTGCTGAAAAGAAAGGGCCTCCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCAGCCTCAACAACCTC