ORFeome > cmahp ORF1 – XORFeome v1.0

cmahp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cmahp
Gene ID: 988338
Gene Page ID: 988334
ORF Xenbase ID: 17269989

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042338
Original XGC clone length: 1776

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11007
Well Location: E08

Sequences - 5ʹ (forward) EST

Accession: JZ823538
dbEST ID: 79641240
Trimmed Sequence: ATGGAACAGAGCAATGACGGGCAAACAGCTCACACACTTTTACACCTTGCATCTGCAGAAGTGGAGAGTTTAAAAGAAGGAATCACCTTTTTACGAAACAAGGAGAGTGGAAAAAACTTTATCATATATAAAAATGGAGAAAAACTACGAGCCTGCAAGAACTTGTGTAAGCACCAAGGAGGGACATTTATTAAAGATATTGAGGACCTCGGGAACAGGACAGTCCGCTGTACAAAGCATAATTGGAAGCTGGATGTAAGTTCAATGAAATATGTGAACCCACCAGACAGTTTTTGCCAAGATGAGTTGGTAATAGAAAATGATGACGAAAATGGCGTTTCACTTGTTGAATTAAGTCCTCCAAATCCTTGGGATAGTGATCCTCGCATGGCGGTATGCTTAGAAGGTGGAGAGGTTCAGGTGACATATCTTACCCATGCATGCATGGATCTCAAGCTTGGAAACAAGCACATGGTGTTTGATCCTTGGCTGATTGGACCTGCTTTTGCTCGAGGATGGTGGTTACTTCATGAGCCTCCATGTGACTGGCTAGAAAGACTGTGCAGAGCAGACTTGATTTATATAAGTCACATGCACTCTGATCATCTTAGTTATCCTACACTCAAGAAGCTCTCTGAAAAAAGACCGGATATTCCTATATATGTTGGAAAAACTGAACGCCCTGTCTTTTGGTACCTGGACAAAAGTGGGGTTAAACTTACCAATATCAATGTTGTCCCTTTTGGAATTTGGCAAGAGGTAGATGGAAAACCTA
Full Trace Sequence: GCAAATATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAACAGAGCAATGACGGGCAAACAGCTCACACACTTTTACACCTTGCATCTGCAGAAGTGGAGAGTTTAAAAGAAGGAATCACCTTTTTACGAAACAAGGAGAGTGGAAAAAACTTTATCATATATAAAAATGGAGAAAAACTACGAGCCTGCAAGAACTTGTGTAAGCACCAAGGAGGGACATTTATTAAAGATATTGAGGACCTCGGGAACAGGACAGTCCGCTGTACAAAGCATAATTGGAAGCTGGATGTAAGTTCAATGAAATATGTGAACCCACCAGACAGTTTTTGCCAAGATGAGTTGGTAATAGAAAATGATGACGAAAATGGCGTTTCACTTGTTGAATTAAGTCCTCCAAATCCTTGGGATAGTGATCCTCGCATGGCGGTATGCTTAGAAGGTGGAGAGGTTCAGGTGACATATCTTACCCATGCATGCATGGATCTCAAGCTTGGAAACAAGCACATGGTGTTTGATCCTTGGCTGATTGGACCTGCTTTTGCTCGAGGATGGTGGTTACTTCATGAGCCTCCATGTGACTGGCTAGAAAGACTGTGCAGAGCAGACTTGATTTATATAAGTCACATGCACTCTGATCATCTTAGTTATCCTACACTCAAGAAGCTCTCTGAAAAAAGACCGGATATTCCTATATATGTTGGAAAAACTGAACGCCCTGTCTTTTGGTACCTGGACAAAAGTGGGGTTAAACTTACCAATATCAATGTTGTCCCTTTTGGAATTTGGCAAGAGGTAGATGGAAAACCTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACAGAGCAATGACGGGCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ828837
dbEST ID: 79646539
Trimmed Sequence: CATGATGCTGCAGTTTTGTAGTGTTGCATTGTTTTCCTTCTCTCGATCCAAGAATACTTTCCAGTCAGGAGGTGTTAGGGGCAGCTTGATTTGAAAATGGTTCCAAAATTGATGGTGGTAGATATCTGGATTGCGCTGAATACGGGTTTGGAATCCAATGTACAGATCATCCCATAGAAGCCCATGTTTCACCACATGCCTAATGACAGTTGCTCTACTGCTTATTTCTTCATATGGGTGGTCACGTTCAGGTCTCTCAGTAGGGAAGGACAGGTCCAAGAAATCCACTAAATAATTGTATCCTTTAGGCAAAGGAACAAAGTGTTCATCTGTTTCAATCATCCTCAGCACAAGATTATAGCCCTTAAACCCAGCCCAGGTGAAATATTCTTTAATCCAGGAGGGATAATGAAAAATCTCATCATCAAACGAAAAAGAATGGATACTAAGGTACGTATCATAGTCCCAGGAATCTTTGAATATTTTTGTTCCAGGAGGTGGATCAATAATTCCATTTTTATCTGTTGGGTCAATTAATAATCTTCCAAGGTCCAGTATTGCTCCAGGTTTGGGAGTCCATGTAACAACATCACTTGTATTTCTTATTAGCATATTAAGTTCAGCTGCATCATTTTTCAGATTTGTCTCTTTTATGTACTTATCTGATGGATGCTCTTCCACAAAATATCCAGCAAAAAG
Full Trace Sequence: TTACAGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGATGCTGCAGTTTTGTAGTGTTGCATTGTTTTCCTTCTCTCGATCCAAGAATACTTTCCAGTCAGGAGGTGTTAGGGGCAGCTTGATTTGAAAATGGTTCCAAAATTGATGGTGGTAGATATCTGGATTGCGCTGAATACGGGTTTGGAATCCAATGTACAGATCATCCCATAGAAGCCCATGTTTCACCACATGCCTAATGACAGTTGCTCTACTGCTTATTTCTTCATATGGGTGGTCACGTTCAGGTCTCTCAGTAGGGAAGGACAGGTCCAAGAAATCCACTAAATAATTGTATCCTTTAGGCAAAGGAACAAAGTGTTCATCTGTTTCAATCATCCTCAGCACAAGATTATAGCCCTTAAACCCAGCCCAGGTGAAATATTCTTTAATCCAGGAGGGATAATGAAAAATCTCATCATCAAACGAAAAAGAATGGATACTAAGGTACGTATCATAGTCCCAGGAATCTTTGAATATTTTTGTTCCAGGAGGTGGATCAATAATTCCATTTTTATCTGTTGGGTCAATTAATAATCTTCCAAGGTCCAGTATTGCTCCAGGTTTGGGAGTCCATGTAACAACATCACTTGTATTTCTTATTAGCATATTAAGTTCAGCTGCATCATTTTTCAGATTTGTCTCTTTTATGTACTTATCTGATGGATGCTCTTCCACAAAATATCCAGCAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGATGCTGCAGTTTTGTAGT