ORFeome > cmpk1 ORF1 – XORFeome v1.0

cmpk1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cmpk1
Gene ID: 980044
Gene Page ID: 980039
ORF Xenbase ID: 17270007

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054975
Original XGC clone length: 651

Human orthology & disease relationships

NCBI Entrez ID: 51727
Ensembl gene IDs: ENSG00000162368
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 223100,248900,307030,603903,608611

Library Location

Plate ID: GDExl11003
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ839543
dbEST ID: 79657245
Trimmed Sequence: ATGCTTTATCGCCTGCTTAAAACTTTGCCCCGAGTTTCTGCAGCGTCTTTTCACTGTGTGCGACACATTATGAAGCCCTTGGTAGTGTTTGTTCTCGGAGGACCAGGCGCAGGAAAAGGAACCCAGTGTGAAAGGATCGTGCAGAAGTATGGGTACACCCACCTCTCAGCTGGAGACCTTCTACGGGACGAGAGGAAGAAACCAGACTCCCAGTATGGTGAGCTTATTGAATCTTACATAAGAGATGGGAAGATTGTGCCTGTGGAGATCACAATCAGCCTGCTACAAAGGGCAATGGAGCGGACCATGGCCATTGATGCCAACAAGCATAAATTCCTAATTGATGGATTCCCTAGAAATGAAGACAACTTGCAAGGCTGGGAAAGAACAATGAATGGAAAAGCAGATGTGTCTTTTGTGCTATTTTTTGATTGTGATAATGAGACCTGTATTGAACGATGCTTGGAGCGAGGGAAGAGCAGCGGTCGGAGTGATGATAACAGGGAGAGTTTAGAAAAGAGAATACAAACATACCTGCAGTCAACAAGACCTATCATCGACCTTTATGAAAAGAGAGGGAAGGTCAGGAAAGTGGATGCCTCCNAATCTGTAAAATGAGGTTTTTACCAAAGTGCAAAATATTTTCGACTT
Full Trace Sequence: TCGGGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTTTATCGCCTGCTTAAAACTTTGCCCCGAGTTTCTGCAGCGTCTTTTCACTGTGTGCGACACATTATGAAGCCCTTGGTAGTGTTTGTTCTCGGAGGACCAGGCGCAGGAAAAGGAACCCAGTGTGAAAGGATCGTGCAGAAGTATGGGTACACCCACCTCTCAGCTGGAGACCTTCTACGGGACGAGAGGAAGAAACCAGACTCCCAGTATGGTGAGCTTATTGAATCTTACATAAGAGATGGGAAGATTGTGCCTGTGGAGATCACAATCAGCCTGCTACAAAGGGCAATGGAGCGGACCATGGCCATTGATGCCAACAAGCATAAATTCCTAATTGATGGATTCCCTAGAAATGAAGACAACTTGCAAGGCTGGGAAAGAACAATGAATGGAAAAGCAGATGTGTCTTTTGTGCTATTTTTTGATTGTGATAATGAGACCTGTATTGAACGATGCTTGGAGCGAGGGAAGAGCAGCGGTCGGAGTGATGATAACAGGGAGAGTTTAGAAAAGAGAATACAAACATACCTGCAGTCAACAAGACCTATCATCGACCTTTATGAAAAGAGAGGGAAGGTCAGGAAAGTGGATGCCTCCNAATCTGTAAAATGAGGTTTTTACCAAAGTGCAAAATATTTTCGACTTGCCAACTTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTGTGCACGAACAGGTCACTATCAGTCAAAATTAAAATCTTATATTTGGCCATTCCACCTAAAAAAAACCCAAAAAAAGAGTACATATAAAAAAATGGGTACATAACC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTTTATCGCCTGCTTAAAACT

Sequences - 3ʹ (reverse) EST

Accession: JZ839542
dbEST ID: 79657244
Trimmed Sequence: GTCGAAAATATTTTGCACTTTGGTAAAAACCTCATCTACAGATTTGGAGGCATCCACTTTCCTGACCTTCCCTCTCTTTTCATAAAGGTCGATGATAGGTCTTGTTGACTGCAGGTATGTTTGTATTCTCTTTTCTAAACTCTCCCTGTTATCATCACTCCGACCGCTGCTCTTCCCTCGCTCCAAGCATCGTTCAATACAGGTCTCATTATCACAATCAAAAAATAGCACAAAAGACACATCTGCTTTTCCATTCATTGTTCTTTCCCAGCCTTGCAAGTTGTCTTCATTTCTAGGGAATCCATCAATTAGGAATTTATGCTTGTTGGCATCAATGGCCATGGTCCGCTCCATTGCCCTTTGTAGCAGGCTGATTGTGATCTCCACAGGCACAATCTTCCCATCTCTTATGTAAGATTCAATAAGCTCACCATACTGGGAGTCTGGTTTCTTCCTCTCGTCCCGTAGAAGGTCTCCAGCTGAGAGGTGGGTGTACCCATACTTCTGCACGATCCTTTCACACTGGGTTCCTTTTCCTGCGCCTGGTCCTCCGAAAAAAAACACTAACCAGGGCTTCATAATGGTGTCGCACACAGTGAAAAAACCCTTCAGAAAACTCGGGGCAAAGTTTTTAAGCAGGGCCAAAAAGCAAGGGTGGCCACTTTGATTGGTACAAAATTTGGCAATTATAAAAAAAGCCATTGGATC
Full Trace Sequence: GGGAAAATGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGAAAATATTTTGCACTTTGGTAAAAACCTCATCTACAGATTTGGAGGCATCCACTTTCCTGACCTTCCCTCTCTTTTCATAAAGGTCGATGATAGGTCTTGTTGACTGCAGGTATGTTTGTATTCTCTTTTCTAAACTCTCCCTGTTATCATCACTCCGACCGCTGCTCTTCCCTCGCTCCAAGCATCGTTCAATACAGGTCTCATTATCACAATCAAAAAATAGCACAAAAGACACATCTGCTTTTCCATTCATTGTTCTTTCCCAGCCTTGCAAGTTGTCTTCATTTCTAGGGAATCCATCAATTAGGAATTTATGCTTGTTGGCATCAATGGCCATGGTCCGCTCCATTGCCCTTTGTAGCAGGCTGATTGTGATCTCCACAGGCACAATCTTCCCATCTCTTATGTAAGATTCAATAAGCTCACCATACTGGGAGTCTGGTTTCTTCCTCTCGTCCCGTAGAAGGTCTCCAGCTGAGAGGTGGGTGTACCCATACTTCTGCACGATCCTTTCACACTGGGTTCCTTTTCCTGCGCCTGGTCCTCCGAAAAAAAACACTAACCAGGGCTTCATAATGGTGTCGCACACAGTGAAAAAACCCTTCAGAAAACTCGGGGCAAAGTTTTTAAGCAGGGCCAAAAAGCAAGGGTGGCCACTTTGATTGGTACAAAATTTGGCAATTATAAAAAAAGCCATTGGATC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGAAAATATTTTGCACTTTGGT