ORFeome > colgalt1 ORF2 – XORFeome v1.0

colgalt1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: colgalt1
Gene ID: 952958
Gene Page ID: 952954
ORF Xenbase ID: 17270325

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127422
Original XGC clone length: 1836

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A07

Sequences - 5ʹ (forward) EST

Accession: JZ837470
dbEST ID: 79655172
Trimmed Sequence: ATGTCCCAGGCCGGTGTCGATCGGCTCCTGAGGGGGCTCCAGCTATTGCTGCTCGTGTTGCGGCTCAGCGCCGGCTACTTCCCGGAAGAACGATGGAATCCGGAATCTTCGCTCCGCAATCCGACCGTCCTGATCGCCCTGTTAGCCCGGAACTCCGAGGGTTCCCTTCCAGAAGTGCTGGGAGCGCTGGACACGCTGCACTACCCGAAGGAGCGGATCTCTTTATGGGTTGCCACAGATCATAATTTGGACAACACCACCGAGATCTTGCGGGAATGGCTGATCAATGTGCAGAATCAGTATCATCACGTGGAGTGGAGACCTCAGGAGCACCCGAGGTGGTTCAAGGACGAGGAAGGCCCCAAGCATTGGTCGCATTCCCGGTACGAATATATCATGAAACTACGACAGGCGGCTCTAACCTCTGCCCGAGAGATGTGGGCTGATTACATTTTTTTCCTGGATGCAGATAACTTGCTGACAAATCCCGAGACTCTGAATCTTCTTATCGCGGAGAACAAGACTGTAGTGGCCCCCATGCTAGATTCCAGAGCTGCGTATTCTAATTTCTGGTGTGGCATGACAACACAGGGTTATTACCGGCGCACCCCCGCATATATGCCATCCCGCCGAAGAGAACCGGCCGGGGTTGCTTTCCCCGTCCCCCATGGTTCACTCTAAGTTTTCTAATATAACCCTTCTTAAGGAGGCTTCCCCGGGGGCTGAAACTTCTACCCCACCTTCACCCCCACAACCCCTTGGGCCTTCCATGGAACATCCTCCGTTTTTTGAATTTTTCCTTTCGGGCCATGCCCTAAACGT
Full Trace Sequence: CGAGGGCCCCTATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGCCGGTGTCGATCGGCTCCTGAGGGGGCTCCAGCTATTGCTGCTCGTGTTGCGGCTCAGCGCCGGCTACTTCCCGGAAGAACGATGGAATCCGGAATCTTCGCTCCGCAATCCGACCGTCCTGATCGCCCTGTTAGCCCGGAACTCCGAGGGTTCCCTTCCAGAAGTGCTGGGAGCGCTGGACACGCTGCACTACCCGAAGGAGCGGATCTCTTTATGGGTTGCCACAGATCATAATTTGGACAACACCACCGAGATCTTGCGGGAATGGCTGATCAATGTGCAGAATCAGTATCATCACGTGGAGTGGAGACCTCAGGAGCACCCGAGGTGGTTCAAGGACGAGGAAGGCCCCAAGCATTGGTCGCATTCCCGGTACGAATATATCATGAAACTACGACAGGCGGCTCTAACCTCTGCCCGAGAGATGTGGGCTGATTACATTTTTTTCCTGGATGCAGATAACTTGCTGACAAATCCCGAGACTCTGAATCTTCTTATCGCGGAGAACAAGACTGTAGTGGCCCCCATGCTAGATTCCAGAGCTGCGTATTCTAATTTCTGGTGTGGCATGACAACACAGGGTTATTACCGGCGCACCCCCGCATATATGCCATCCCGCCGAAGAGAACCGGCCGGGGTTGCTTTCCCCGTCCCCCATGGTTCACTCTAAGTTTTCTAATATAACCCTTCTTAAGGAGGCTTCCCCGGGGGCTGAAACTTCTACCCCACCTTCACCCCCACAACCCCTTGGGCCTTCCATGGAACATCCTCCGTTTTTTGAATTTTTCCTTTCGGGCCATGCCCTAAACGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCCAGGCCGGTGT

Sequences - 3ʹ (reverse) EST

Accession: JZ837469
dbEST ID: 79655171
Trimmed Sequence: TAATTCATCCCGGGCAGTGTTGTCAAAAGGGGAGCCCAAGGAAGGGGAGTTTAAGGCCTCGCTGCGCAGCTTCTCCTGCTGTTGTGTCTTGCGCGACTTTGCTCGGTCCCAGTCGGTGGGTTCCGTCAGATTGTCCCACAGCACCGAGGTCTCCGTGTCACTAATGTAGCCCTCATCTCCAGTGTAGTGGGTGGGATACAGAAGGAGAGGCTCCACTGAGAAAGCCAGAAGGTCTCGAGGGGAGAAATGGGAGGAATAGTCACAGATGGGGTGCTTGTCATACATGACTGGCAAGAACTCGTCTACAGGCAGCATCTTCACAAGAGGTTCTGCATTCAGCAGCTTTTTTGCCCCACGCAAGGAGATCAGATACCCCACGGTCCAATAGGAATAATCGGATACCACCAAATTACGGACTCCAGGCACAGGCTCTTCTGGTTCGTCAACCTGCATCCTCTTCCTGCCCAGGTAAATGAAATCCCAGTCCAGCTTGGCTGTCTCTAGATCATGCAGGAGCGTCTGCTGCCGCCGCTTAAGGTAAATCTCAAAACGAAGGTCATCCGCGAACCCTGCTGAAACGCCCCACTGCGCTTCGGAAAAAGCCTCCGTGATTTTTTAATGATTGGAAAAAAAGCCCATCTACCCCCCCAATCCAAAGGCGGGCGAGGGGAAGCGGGCGTTGGAGGGAAGTAAAACACGTGGGGGCCGCATTAAAAAAACCGGGAATAATAAATGGGGGTTTTGGTGATTGTGGGCGGGTTTTCTA
Full Trace Sequence: AAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTCATCCCGGGCAGTGTTGTCAAAAGGGGAGCCCAAGGAAGGGGAGTTTAAGGCCTCGCTGCGCAGCTTCTCCTGCTGTTGTGTCTTGCGCGACTTTGCTCGGTCCCAGTCGGTGGGTTCCGTCAGATTGTCCCACAGCACCGAGGTCTCCGTGTCACTAATGTAGCCCTCATCTCCAGTGTAGTGGGTGGGATACAGAAGGAGAGGCTCCACTGAGAAAGCCAGAAGGTCTCGAGGGGAGAAATGGGAGGAATAGTCACAGATGGGGTGCTTGTCATACATGACTGGCAAGAACTCGTCTACAGGCAGCATCTTCACAAGAGGTTCTGCATTCAGCAGCTTTTTTGCCCCACGCAAGGAGATCAGATACCCCACGGTCCAATAGGAATAATCGGATACCACCAAATTACGGACTCCAGGCACAGGCTCTTCTGGTTCGTCAACCTGCATCCTCTTCCTGCCCAGGTAAATGAAATCCCAGTCCAGCTTGGCTGTCTCTAGATCATGCAGGAGCGTCTGCTGCCGCCGCTTAAGGTAAATCTCAAAACGAAGGTCATCCGCGAACCCTGCTGAAACGCCCCACTGCGCTTCGGAAAAAGCCTCCGTGATTTTTTAATGATTGGAAAAAAAGCCCATCTACCCCCCCAATCCAAAGGCGGGCGAGGGGAAGCGGGCGTTGGAGGGAAGTAAAACACGTGGGGGCCGCATTAAAAAAACCGGGAATAATAAATGGGGGTTTTGGTGATTGTGGGCGGGTTTTCTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCATCCCGGGCAGT