ORFeome > commd10 ORF1 – XORFeome v1.0

commd10 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: commd10
Gene ID: 941191
Gene Page ID: 941184
ORF Xenbase ID: 17270337

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125987
Original XGC clone length: 600

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: B02

Sequences - 5ʹ (forward) EST

Accession: JZ838294
dbEST ID: 79655996
Trimmed Sequence: ATGGCGACTGCAATCGTGAAGGAGACGGCCAGCATTAAACATGCTGTGTCGATAATCAATTCCATGGATGTGGGGAAATTTCCCAGACTGCTTTCTCGTATCGTCCAAAAACTTCATCTGAAGGCTGAACGCAGTTTTAGTGACGAGGAAGAAGAAAAGCTTCAGGCAGCATTTGCATTGGATAAACAGGATCTCAACTTAGTCTTAGAGACTATCGCCTTTATTTTGGAACAGGCTGTATATCATAATATGAAAACAACAGTGTTACGCCAGCAGTTGGAGAACATCCATCTTGAGCAGAGTAAAGTTGAAGCTTTTGTTAATGCCTGGGAGGTTTCAGGCCAGGACACTGTAGAAAAGTTCAGACAAAGAATCTTGGCTCCCAAAAAGCTGGAGACAACTGCCTGGCAGCTCAACCTCCAGATGGCTCAATCCACCCAAGCAAAAATGAAATCTCCCCAGGCTGTGATAGAACTTGGAGTTAGCAGTGAAGACACAAAGAATCTGGAGAAAGTGTTTGTGGAGTTTAACCACAAGGAGCTGTTGGAGTTCTATAACAAGCTTGAGACTATCCAGGCACAGCTGGATTCCCTTACGTT
Full Trace Sequence: TCGAGGGCCAAATAANTGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGACTGCAATCGTGAAGGAGACGGCCAGCATTAAACATGCTGTGTCGATAATCAATTCCATGGATGTGGGGAAATTTCCCAGACTGCTTTCTCGTATCGTCCAAAAACTTCATCTGAAGGCTGAACGCAGTTTTAGTGACGAGGAAGAAGAAAAGCTTCAGGCAGCATTTGCATTGGATAAACAGGATCTCAACTTAGTCTTAGAGACTATCGCCTTTATTTTGGAACAGGCTGTATATCATAATATGAAAACAACAGTGTTACGCCAGCAGTTGGAGAACATCCATCTTGAGCAGAGTAAAGTTGAAGCTTTTGTTAATGCCTGGGAGGTTTCAGGCCAGGACACTGTAGAAAAGTTCAGACAAAGAATCTTGGCTCCCAAAAAGCTGGAGACAACTGCCTGGCAGCTCAACCTCCAGATGGCTCAATCCACCCAAGCAAAAATGAAATCTCCCCAGGCTGTGATAGAACTTGGAGTTAGCAGTGAAGACACAAAGAATCTGGAGAAAGTGTTTGTGGAGTTTAACCACAAGGAGCTGTTGGAGTTCTATAACAAGCTTGAGACTATCCAGGCACAGCTGGATTCCCTTACGTTGCCAACTTTCTTGTACAAAGTTTGCATTATAAGAAAACAATGCTTATCAATTTGTTGCCATCGAACAGGTCACTATCCGGTCAAATAAAATCATTTTTTTGCCATCCCGCGGAATATCCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAATTTCCTGGTTCCCTCTTGGGCCCGGGGCCCAGGAAAGGCCCCACAAAAACCGTCAAACACCCGGGGGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACTGCAATCGTGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838293
dbEST ID: 79655995
Trimmed Sequence: CGTAAGGGAATCCAGCTGTGCCTGGATAGTCTCAAGCTTGTTATAGAACTCCAACAGCTCCTTGTGGTTAAACTCCACAAACACTTTCTCCAGATTCTTTGTGTCTTCACTGCTAACTCCAAGTTCTATCACAGCCTGGGGAGATTTCATTTTTGCTTGGGTGGATTGAGCCATCTGGAGGTTGAGCTGCCAGGCAGTTGTCTCCAGCTTTTTGGGAGCCAAGATTCTTTGTCTGAACTTTTCTACAGTGTCCTGGCCTGAAACCTCCCAGGCATTAACAAAAGCTTCAACTTTACTCTGCTCAAGATGGATGTTCTCCAACTGCTGGCGTAACACTGTTGTTTTCATATTATGATATACAGCCTGTTCCAAAATAAAGGCGATAGTCTCTAAGACTAAGTTGAGATCCTGTTTATCCAATGCAAATGCTGCCTGAAGCTTTTCTTCTTCCTCGTCACTAAAACTGCGTTCAGCCTTCAGATGAAGTTTTTGGACGATACGAGAAAGCAATCTGGGAAATTTCCCCACATCCATTGGAATTGATTATCGACACAGCAAGTTAAATGCTGGCCGTCTCCCTTCCCATTGCATTCGCCATGG
Full Trace Sequence: AAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGTAAGGGAATCCAGCTGTGCCTGGATAGTCTCAAGCTTGTTATAGAACTCCAACAGCTCCTTGTGGTTAAACTCCACAAACACTTTCTCCAGATTCTTTGTGTCTTCACTGCTAACTCCAAGTTCTATCACAGCCTGGGGAGATTTCATTTTTGCTTGGGTGGATTGAGCCATCTGGAGGTTGAGCTGCCAGGCAGTTGTCTCCAGCTTTTTGGGAGCCAAGATTCTTTGTCTGAACTTTTCTACAGTGTCCTGGCCTGAAACCTCCCAGGCATTAACAAAAGCTTCAACTTTACTCTGCTCAAGATGGATGTTCTCCAACTGCTGGCGTAACACTGTTGTTTTCATATTATGATATACAGCCTGTTCCAAAATAAAGGCGATAGTCTCTAAGACTAAGTTGAGATCCTGTTTATCCAATGCAAATGCTGCCTGAAGCTTTTCTTCTTCCTCGTCACTAAAACTGCGTTCAGCCTTCAGATGAAGTTTTTGGACGATACGAGAAAGCAATCTGGGAAATTTCCCCACATCCATTGGAATTGATTATCGACACAGCAAGTTAAATGCTGGCCGTCTCCCTTCCCATTGCATTCGCCATGGTGCCAACTTTTTTGGTACAAGTTGGCATTAGTAAGAAACCATTGCTCATTCATTTTGTTGCATGGAAGAGGGTCCTTATAAAAAAAAAAAAAAAAAAAATAAAAAGTGTCCCCAGCGTGGCAAACTCGACAGTCGTTGACGAACACCTCCTTAAACCTGGGTGCCCCGGAGGGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGTAAGGGAATCCAGCTGT