ORFeome > commd8 ORF1 – XORFeome v1.0

commd8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: commd8
Gene ID: 942442
Gene Page ID: 942436
ORF Xenbase ID: 17270373

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084128
Original XGC clone length: 552

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ839953
dbEST ID: 79657655
Trimmed Sequence: ATGGAGGGAGAAGAACATAGCGGGTTACGTCTGATCGGGAAGCTGCCTGTAGCGCAGTGCCCGCAGTTCTTTCACAAAGTCATAGATGGAGTATGTGGCCGGGCACAGCCTCGTTTCCAGGATTATGGTAATATATGGAGCCTTCGGGAATGGCTGGAAGTTTTGGAAGATTCTGCAACATTCTTCAAGAACAGCATTGGTACTGATGTAAACGCAGATGAGGCTTCTAATGGGTTAAATGGGCTCAGTGCAGAACACCAAGAGATAATCCTTAAATGTTTGAAAAGTAGGAAACCTGAAATAGAGGAAGCCGTTGTGGAGAAGGCATGTGCCATGTCATCTGCATATTTACAGGATTTTGACTGGCAGTTAAAGCTTGCCCTTTCTAGTGATAAGCTCTCGGCGCTGCAGATGCCACTTGTAAATCTCGATTTAGATATCGCAAAAAATGGTTCGGTTACACCCGTCTCTGTAGAGATGAACAAAGAGGAGCTTCAGAACCTTATACATTCTCTAGAGGCAGCTAATAAGGTCGTCCTTCAGCTGAAATT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGGAGAAGAACATAGCGGGTTACGTCTGATCGGGAAGCTGCCTGTAGCGCAGTGCCCGCAGTTCTTTCACAAAGTCATAGATGGAGTATGTGGCCGGGCACAGCCTCGTTTCCAGGATTATGGTAATATATGGAGCCTTCGGGAATGGCTGGAAGTTTTGGAAGATTCTGCAACATTCTTCAAGAACAGCATTGGTACTGATGTAAACGCAGATGAGGCTTCTAATGGGTTAAATGGGCTCAGTGCAGAACACCAAGAGATAATCCTTAAATGTTTGAAAAGTAGGAAACCTGAAATAGAGGAAGCCGTTGTGGAGAAGGCATGTGCCATGTCATCTGCATATTTACAGGATTTTGACTGGCAGTTAAAGCTTGCCCTTTCTAGTGATAAGCTCTCGGCGCTGCAGATGCCACTTGTAAATCTCGATTTAGATATCGCAAAAAATGGTTCGGTTACACCCGTCTCTGTAGAGATGAACAAAGAGGAGCTTCAGAACCTTATACATTCTCTAGAGGCAGCTAATAAGGTCGTCCTTCAGCTGAAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACCAACAGGTCACTATCAGTCAAAATAAAATCATTATTTTGCATCCAGCTTGATATCCCCTATAGTGAGTCGTATTACATGGTCAAAAAAAAAATCCGGGAAACTCAGGCCCGGGGTCTCAAATTCTCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGGAGAAGAACATAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839952
dbEST ID: 79657654
Trimmed Sequence: TTTCAGCTGAAGGACGACCTTATTAGCTGCCTCTAGAGAATGTATAAGGTTCTGAAGCTCCTCTTTGTTCATCTCTACAGAGACGGGTGTAACCGAACCATTTTTTGCGATATCTAAATCGAGATTTACAAGTGGCATCTGCAGCGCCGAGAGCTTATCACTAGAAAGGGCAAGCTTTAACTGCCAGTCAAAATCCTGTAAATATGCAGATGACATGGCACATGCCTTCTCCACAACGGCTTCCTCTATTTCAGGTTTCCTACTTTTCAAACATTTAAGGATTATCTCTTGGTGTTCTGCACTGAGCCCATTTAACCCATTAGAAGCCTCATCTGCGTTTACATCAGTACCAATGCTGTTCTTGAAGAATGTTGCAGAATCTTCCAAAACTTCCAGCCATTCCCGAAGGCTCCATATATTACCATAATCCTGGAAACGAGGCTGTGCCCGGCCACATACTCCATCTATGACTTTGTGAAAGAACTGCGGGCACTGCGCTACAGGCAGCTTCCCGATCAGACGTAACCCGCTATGTTCTTCTCCCTCCGTGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTACTAGGGGAAACCAGCCTGGAGGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCAGCTGAAGGACGACCTTATTAGCTGCCTCTAGAGAATGTATAAGGTTCTGAAGCTCCTCTTTGTTCATCTCTACAGAGACGGGTGTAACCGAACCATTTTTTGCGATATCTAAATCGAGATTTACAAGTGGCATCTGCAGCGCCGAGAGCTTATCACTAGAAAGGGCAAGCTTTAACTGCCAGTCAAAATCCTGTAAATATGCAGATGACATGGCACATGCCTTCTCCACAACGGCTTCCTCTATTTCAGGTTTCCTACTTTTCAAACATTTAAGGATTATCTCTTGGTGTTCTGCACTGAGCCCATTTAACCCATTAGAAGCCTCATCTGCGTTTACATCAGTACCAATGCTGTTCTTGAAGAATGTTGCAGAATCTTCCAAAACTTCCAGCCATTCCCGAAGGCTCCATATATTACCATAATCCTGGAAACGAGGCTGTGCCCGGCCACATACTCCATCTATGACTTTGTGAAAGAACTGCGGGCACTGCGCTACAGGCAGCTTCCCGATCAGACGTAACCCGCTATGTTCTTCTCCCTCCGTGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACCGGGCCCTAATCATTCAAAATAAAATCAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCAGCTGAAGGACGAC