ORFeome > comt ORF1 – XORFeome v1.0

comt ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: comt
Gene ID: 6252788
Gene Page ID: 948946
ORF Xenbase ID: 17270379

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123206
Original XGC clone length: 645

Human orthology & disease relationships

NCBI Entrez ID: 1312
Ensembl gene IDs: ENSG00000093010
Directly associated (OMIM) disease MIM numbers: 167870,181500
Indirectly associated (Lage, et al.) disease MIM numbers: 223360,601098

Library Location

Plate ID: GDExl11088
Well Location: H08

Sequences - 5สน (forward) EST

Accession: JZ838286
dbEST ID: 79655988
Trimmed Sequence: ATGGCCCAGAGTAAGGAACAGCGGATCTTTGATTTTGTGCAGCAGAATGCAGTTCGTGGGGACCCCCAAAGCGTAATTGACCATATCGATGAATACTGCAGTAAAAAGGAGTGGGCAATGAATGTGGGTGATGAGAAAGGTCTGATTCTGGATCAAGTACTTAAAGAGACCGAGCCATTGGTGGTACTGGAACTGGGCACTTACTGTGGATACTCTGCTATCCGCATAGCTCGGCTGCTGAAGCCCAGCGCTCGACTACTTACTGTGGAGATTAACCCAGATAATGCTTCCATTGCCAAACAAATGATTGAATTTGCCGGAGTAGAAAACAAGGTGCAGATACTTCTTGGCTCCACCGAGACTGTTATTCCTCAACTGAAGACAGAGCATGGTGTAAAGCACTTTGATTTCGTATTTATTGATCACTTTAAGATCAGATACGTGCCTGACACTATATTACTGGAGGAATGTGGTTTACTCAGAAAGGGCTCAGTCTTACTCGCAGACAACGTGGTGCAACCTGGAGCACCAGAATTTCTTAAGTACGTCCGGACAAGCGGTCGATATGACTGTACCAACTACCCGGCCCATGTTGAATACACGGATAGAGCAGATGCTTTGGAAAAGGCTGTGTTTAGAGGGTG
Full Trace Sequence: TCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGAGTAAGGAACAGCGGATCTTTGATTTTGTGCAGCAGAATGCAGTTCGTGGGGACCCCCAAAGCGTAATTGACCATATCGATGAATACTGCAGTAAAAAGGAGTGGGCAATGAATGTGGGTGATGAGAAAGGTCTGATTCTGGATCAAGTACTTAAAGAGACCGAGCCATTGGTGGTACTGGAACTGGGCACTTACTGTGGATACTCTGCTATCCGCATAGCTCGGCTGCTGAAGCCCAGCGCTCGACTACTTACTGTGGAGATTAACCCAGATAATGCTTCCATTGCCAAACAAATGATTGAATTTGCCGGAGTAGAAAACAAGGTGCAGATACTTCTTGGCTCCACCGAGACTGTTATTCCTCAACTGAAGACAGAGCATGGTGTAAAGCACTTTGATTTCGTATTTATTGATCACTTTAAGATCAGATACGTGCCTGACACTATATTACTGGAGGAATGTGGTTTACTCAGAAAGGGCTCAGTCTTACTCGCAGACAACGTGGTGCAACCTGGAGCACCAGAATTTCTTAAGTACGTCCGGACAAGCGGTCGATATGACTGTACCAACTACCCGGCCCATGTTGAATACACGGATAGAGCAGATGCTTTGGAAAAGGCTGTGTTTAGAGGGTGCCAACTTTCTTGGTACAAAGTGGCATTATAAGAAAGCATTGTTTAACAATTTGTTGCAACGAAACAGGTCCATAACAATGCAAATAAAATCATTTATTGGGCCTTCGGGCCTTAATTCCCCCAAAAAAAAAAAAAAAAAAAAAAAAAAGAAACAAAAAACTAATTTATACGGGGAACCCTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGAGTAAGGAA

Sequences - 3สน (reverse) EST

Accession: JZ838285
dbEST ID: 79655987
Trimmed Sequence: CCCTCTAAACACAGCCTTTTCCAAAGCATCTGCTCTATCCGTGTATTCAACATGGGCCGGGTAGTTGGTACAGTCATATCGACCGCTTGTCCGGACGTACTTAAGAAATTCTGGTGCTCCAGGTTGCACCACGTTGTCTGCGAGTAAGACTGAGCCCTTTCTGAGTAAACCACATTCCTCCAGTAATATAGTGTCAGGCACGTATCTGATCTTAAAGTGATCAATAAATACGAAATCAAAGTGCTTTACACCATGCTCTGTCTTCAGTTGAGGAATAACAGTCTCGGTGGAGCCAAGAAGTATCTGCACCTTGTTTTCTACTCCGGCAAATTCAATCATTTGTTTGGCAATGGAAGCATTATCTGGGTTAATCTCCACAGTAAGTAGTCGAGCGCTGGGCTTCAGCAGCCGAGCTATGCGGATAGCAGAGTATCCACAGTAAGTGCCCAGTTCCAGTACCACCAATGGCTCGGTCTCTTTAAGTACTTGATCCAGAATCAGACCTTTCTCATCACCCACATTCATTGCCCACTCCTTTTTACCGGCATATTCATCGATATGGTCAATTACACTTTTGGGGTCCCCGGAAATTCAATTCGCTGCCCAAAGTCAAAAATCCGCTGTTCCGTTACTCTTGGCCATGGTGCGAACTTTTGTGGTACAATTTTGGCATTAAAAAAAGGCATTTCCTCATAAATTTTGTTGCCAGCAAAAAAAGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAACAGAAA
Full Trace Sequence: GGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCCTCTAAACACAGCCTTTTCCAAAGCATCTGCTCTATCCGTGTATTCAACATGGGCCGGGTAGTTGGTACAGTCATATCGACCGCTTGTCCGGACGTACTTAAGAAATTCTGGTGCTCCAGGTTGCACCACGTTGTCTGCGAGTAAGACTGAGCCCTTTCTGAGTAAACCACATTCCTCCAGTAATATAGTGTCAGGCACGTATCTGATCTTAAAGTGATCAATAAATACGAAATCAAAGTGCTTTACACCATGCTCTGTCTTCAGTTGAGGAATAACAGTCTCGGTGGAGCCAAGAAGTATCTGCACCTTGTTTTCTACTCCGGCAAATTCAATCATTTGTTTGGCAATGGAAGCATTATCTGGGTTAATCTCCACAGTAAGTAGTCGAGCGCTGGGCTTCAGCAGCCGAGCTATGCGGATAGCAGAGTATCCACAGTAAGTGCCCAGTTCCAGTACCACCAATGGCTCGGTCTCTTTAAGTACTTGATCCAGAATCAGACCTTTCTCATCACCCACATTCATTGCCCACTCCTTTTTACCGGCATATTCATCGATATGGTCAATTACACTTTTGGGGTCCCCGGAAATTCAATTCGCTGCCCAAAGTCAAAAATCCGCTGTTCCGTTACTCTTGGCCATGGTGCGAACTTTTGTGGTACAATTTTGGCATTAAAAAAAGGCATTTCCTCATAAATTTTGTTGCCAGCAAAAAAAGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATAAAAAAAAACAGAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCTCTAAACACAGCCTTTTCCA